MECOM cDNA

• Description :

  MDS1 is a transcriptional regulator and oncoprotein that may be involved in hematopoiesis, apoptosis, development, and cell differentiation and proliferation. Several transcript variants encoding a few different isoforms have been found for this gene.

• Product Name Alternative :

  MDS1 and EVI1 complex locus, myelodysplasia syndrome 1, ecotropic viral integration site 1, MDS1, EVI1, PRDM3, MDS1-EVI1

• Chromosomal Location :

  3q26

• Antigen Species :

  Human

• Vector Type :

  PATGen (puc19-derived cloning vector)

• Sequence :

  ATGAGATCCAAAGGCAGGGCAAGGAAACTGGCCACAAATAATGAGTGTGTATATGGCAACTACCCTGAAATACCTTTGGAAGAAATGCCAGATGCAGATGGAGTAGCCAGCACTCCCTCCCTCAATATTCAAGAGCCATGCTCTCCTGCCACATCCAGTGAAGCATTCACTCCAAAGGAGGGTTCTCCTTACAAAGCCCCCATCTACATCCCTGATGATATCCCCATTCCTGCTGAGTTTGAACTTCGAGAGTCAAATATGCCTGGGGCAGGACTAGGAATATGGACCAAAAGGAAGATCGAAGTAGGTGAAAAGTTTGGGCCTTATGTGGGAGAGCAGAGGTCAAACCTGAAAGACCCCAGTTATGGATGGGAGGTACATCTTCCAAGGTCTCGGAGGGTAAGCGTTCACTCTTGGTTGTATTTGGGGAAGAGAAGCTCAGACGTAGGAATAGCCTTCTCTCAGGCTGATGTCTACATGCCTGGACTGCAGTGTGCCTTCCTCTCGTAG

• Additionnal Information :

  PRDM3, Myelodysplasia syndrome protein 1, Myelodysplasia syndrome 1, MRI, Modulator of retrovirus infection homolog, MDS1-EVI1, MDS1 EVI1, MDS1 and EVI1 complex locus, MDS1, EVI1, Ecotropic viral integration site 1, Cell cycle regulator of non-homologous end joining, Cell cycle regulator of non homologous end joining, C7orf49, ATGD0398-10 µg, ATGD0398-20 µg, ATGD0398-50 µg, ATGD0398-100 µg, ATGD0398-250 µg, ATGD0398-500 µg, ATGD0398-1 mg, ATGD0398-010, ATGD0398-020, ATGD0398-050, ATGD0398-100, ATGD0398-250, ATGD0398-500, ATGD0398-01M

• Storage Conditions :

  Store the plasmid at -20C.

• Formulation :

  Lyophilized

• Scientific Category :

  Epigenomics (Transcription & Translation)

• Omim :

  600049

• NCBI Accession Number :

  NP_004982.1

• Species :

  Human

• Preparation :

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference :

  NM_004991.2

• DNA Size :

  510bp

• Vector Description :

  This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.