RAP2B cDNA

• Description :

  RAP2B belongs to the Ras-related protein family. RAP2B is small GTP-binding protein which cycles between a GDP-bound inactive and a GTP-bound active form. It is involved in EGFR and CHRM3 signaling pathways through stimulation of PLCE1.

• Product Name Alternative :

  Ras-related protein Rap-2b, RAP2B, Member of RAS oncogene family, Small GTP binding protein, Ras family small GTP binding protein RAP2B

• Chromosomal Location :

  3q25.2

• Antigen Species :

  Human

• Vector Type :

  PATGen (puc19-derived cloning vector)

• Sequence :

  ATGAGAGAGTACAAAGTGGTGGTGCTGGGCTCGGGCGGCGTGGGCAAGTCCGCGCTCACCGTGCAGTTCGTGACGGGCTCCTTCATCGAGAAGTACGACCCGACCATCGAAGACTTTTACCGCAAGGAGATTGAGGTGGACTCGTCGCCGTCGGTGCTGGAGATCCTGGATACGGCGGGCACCGAGCAGTTCGCGTCCATGCGGGACCTGTACATCAAGAACGGCCAGGGCTTCATCCTGGTCTACAGCCTCGTCAACCAGCAGAGCTTCCAGGACATCAAGCCCATGCGGGACCAGATCATCCGCGTGAAGCGGTACGAGCGCGTGCCCATGATCCTGGTGGGCAACAAGGTGGACCTGGAGGGTGAGCGCGAGGTCTCGTACGGGGAGGGCAAGGCCCTGGCTGAGGAGTGGAGCTGCCCCTTCATGGAGACGTCGGCCAAAAACAAAGCCTCGGTAGACGAGCTATTTGCCGAGATCGTGCGGCAGATGAACTACGCGGCGCAGCCCAACGGCGATGAGGGCTGCTGCTCGGCCTGCGTGATCCTCTGA

• Additionnal Information :

  Small GTP binding protein, Ras-related protein Rap-2b, Ras-related protein RAP2B, Ras related protein RAP2B, Ras related protein Rap 2b, Ras family small GTP binding protein RAP2B, RAP2B, P61225, Member of RAS oncogene family, ATGD0385-10 µg, ATGD0385-20 µg, ATGD0385-50 µg, ATGD0385-100 µg, ATGD0385-250 µg, ATGD0385-500 µg, ATGD0385-1 mg, ATGD0385-010, ATGD0385-020, ATGD0385-050, ATGD0385-100, ATGD0385-250, ATGD0385-500, ATGD0385-01M

• Storage Conditions :

  Store the plasmid at -20C.

• Formulation :

  Lyophilized

• Scientific Category :

  Signal Transduction

• Omim :

  179541

• NCBI Accession Number :

  NP_002877.2

• Species :

  Human

• Preparation :

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference :

  NM_002886.3

• DNA Size :

  552bp

• Vector Description :

  This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.