POLR2E cDNA

• Description:

  POLR2E encodes the fifth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit is shared by the other two DNA-directed RNA polymerases and is present in two-fold molar excess over the other polymerase subunits. An interaction between this subunit and a hepatitis virus transactivating protein has been demonstrated, suggesting that interaction between transcriptional activators and the polymerase can occur through this subunit. A pseudogene is located on chromosome 11.

• Product Name Alternative:

  HRPB25, hsRPB5, RPABC1, RPB5, XAP4

• Chromosomal Location:

  19p13.3

• Antigen Species:

  Human

• Vector Type:

  PATGen (puc19-derived cloning vector)

• Sequence:

  ATGGACGACGAGGAGGAGACGTACCGGCTCTGGAAAATCCGCAAGACCATCATGCAGCTGTGCCACGACCGTGGCTATCTGGTGACCCAGGACGAGCTTGACCAGACCCTGGAGGAGTTCAAAGCCCAATTTGGGGACAAGCCGAGTGAGGGGCGGCCGCGGCGCACGGACCTCACCGTGCTGGTGGCCCACAACGATGACCCCACCGACCAGATGTTTGTGTTCTTTCCAGAGGAGCCCAAGGTGGGCATCAAGACCATCAAGGTGTACTGCCAGCGCATGCAGGAGGAGAACATCACACGGGCTCTCATCGTGGTGCAGCAGGGCATGACACCCTCCGCCAAGCAGTCCCTGGTCGACATGGCCCCCAAGTACATCCTGGAGCAGTTTCTGCAGCAGGAGCTGCTCATCAACATCACGGAGCACGAGCTAGTCCCTGAGCACGTCGTCATGACCAAGGAGGAGGTGACAGAGCTGCTGGCCCGATATAAGCTCCGAGAGAACCAGCTGCCCAGGATCCAGGCGGGGGACCCTGTGGCGCGCTACTTTGGGATAAAGCGTGGGCAGGTGGTGAAGATCATCCGGCCCAGTGAGACGGCTGGCAGGTACATCACCTACCGGCTGGTGCAGTAG

• Additionnal Information:

  POLR2E, hRPB25, hsRPB5, RPABC1, RPB5, XAP4, POLR2E, ATGD0325-10 µg, ATGD0325-20 µg, ATGD0325-50 µg, ATGD0325-100 µg, ATGD0325-250 µg, ATGD0325-500 µg, ATGD0325-1 mg, ATGD0325-10, ATGD0325-20, ATGD0325-50, ATGD0325-100, ATGD0325-250, ATGD0325-500, ATGD0325-1

• Storage Conditions:

  Store the plasmid at -20C.

• Formulation:

  Lyophilized

• Scientific Category:

  Epigenomics (Transcription & Translation)

• Omim:

  180664

• NCBI Accession Number:

  NP_002686.2

• Species:

  Human

• Preparation:

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference:

  NM_002695.3

• DNA Size:

  633bp

• Vector Description:

  This shuttle vector contains the complete ORF. It is inseted Nde I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.