MBD3 cDNA

• Description :

  DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. This gene belongs to a family of nuclear proteins which are characterized by the presence of a methyl-CpG binding domain (MBD) . The encoded protein is a subunit of the NuRD, a multisubunit complex containing nucleosome remodeling and histone deacetylase activities. Unlike the other family members, the encoded protein is not capable of binding to methylated DNA. The protein mediates the association of metastasis-associated protein 2 with the core histone deacetylase complex. Alternative splicing results in multiple transcript variants of this gene.

• Chromosomal Location :

  19p13.3

• Antigen Species :

  Human

• Vector Type :

  PATGen (puc19-derived cloning vector)

• Sequence :

  ATGGAGCGGAAGAGGTGGGAGTGCCCGGCGCTCCCGCAGGGCTGGGAGAGGGAAGAAGTGCCCAGAAGGTCGGGGCTGTCGGCCGGCCACAGGGATGTCTTTTACTATAGCCCGAGCGGGAAGAAGTTCCGCAGCAAGCCGCAGCTGGCGCGCTACCTGGGCGGCTCCATGGACCTGAGCACCTTCGACTTCCGCACGGGCAAGATGCTGATGAGCAAGATGAACAAGAGCCGCCAGCGCGTGCGCTACGACTCCTCCAACCAGGTCAAGGGCAAGCCCGACCTGAACACGGCGCTGCCCGTGCGCCAGACGGCGTCCATCTTCAAGCAGCCGGTGACCAAGATTACCAACCACCCCAGCAACAAGGTCAAGAGCGACCCGCAGAAGGCGGTGGACCAGCCGCGCCAGCTCTTCTGGGAGAAGAAGCTGAGCGGCCTGAACGCCTTCGACATTGCTGAGGAGCTGGTCAAGACCATGGACCTCCCCAAGGGCCTGCAGGGGGTGGGACCTGGCTGCACGGATGAGACGCTGCTGTCGGCCATCGCCAGCGCCCTGCACACTAGCACCATGCCCATCACGGGACAGCTCTCGGCCGCCGTGGAGAAGAACCCCGGCGTATGGCTCAACACCACGCAGCCCCTGTGCAAAGCCTTCATGGTGACCGACGAGGACATCAGGAAGCAGGAAGAGCTGGTGCAGCAGGTGCGGAAGCGGCTGGAGGAGGCGCTGATGGCCGACATGCTGGCGCACGTGGAGGAGCTGGCCCGTGACGGGGAGGCGCCGCTGGACAAGGCCTGCGCTGAGGACGACGACGAGGAAGACGAGGAGGAGGAGGAGGAGGAGCCCGACCCGGACCCGGAGATGGAGCACGTCTAG

• Additionnal Information :

  MBD3, MBD3, ATGD0298-10 µg, ATGD0298-20 µg, ATGD0298-50 µg, ATGD0298-100 µg, ATGD0298-250 µg, ATGD0298-500 µg, ATGD0298-1 mg, ATGD0298-10, ATGD0298-20, ATGD0298-50, ATGD0298-100, ATGD0298-250, ATGD0298-500, ATGD0298-1

• Storage Conditions :

  Store the plasmid at -20C.

• Formulation :

  Lyophilized

• Scientific Category :

  Epigenomics (Transcription & Translation)

• Omim :

  603573

• NCBI Accession Number :

  NP_003917.1

• Species :

  Human

• Preparation :

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference :

  NM_003926.5

• DNA Size :

  876bp

• Vector Description :

  This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.