UBE2K cDNA

• Description :

  UBE2K encoded by this gene belongs to the ubiquitin-conjugating enzyme family. UBE2K interacts with RING finger proteins, and it can ubiquitinate huntingtin, UBE2K product for Huntington's disease. Known functions for UBE2K include a role in aggregate formation of expanded polyglutamine proteins and the suppression of apoptosis in polyglutamine diseases, a role in the dislocation of newly synthesized MHC class I heavy chains from the endoplasmic reticulum, and involvement in foam cell formation. Multiple transcript variants encoding different isoforms have been identified for this gene.

• Product Name Alternative :

  Ubiquitin-conjugating enzyme E2 K isoform 1, E2-25K, HIP2, HYPG, LIG, UBC1

• Chromosomal Location :

  4p14

• Antigen Species :

  Human

• Vector Type :

  PATGen (puc19-derived cloning vector)

• Sequence :

  ATGGCCAACATCGCGGTGCAGCGAATCAAGCGGGAGTTCAAGGAGGTGCTGAAGAGCGAGGAGACGAGCAAAAATCAAATTAAAGTAGATCTTGTAGATGAGAATTTTACAGAATTAAGAGGAGAAATAGCAGGACCTCCAGACACACCATATGAAGGAGGAAGATACCAACTAGAGATAAAAATACCAGAAACATACCCATTTAATCCCCCTAAGGTCCGGTTTATCACTAAAATATGGCATCCTAATATTAGTTCCGTCACAGGGGCTATTTGTTTGGATATCCTGAAAGATCAATGGGCAGCTGCAATGACTCTCCGCACGGTATTATTGTCATTGCAAGCACTATTGGCAGCTGCAGAGCCAGATGATCCACAGGATGCTGTAGTAGCAAATCAGTACAAACAAAATCCCGAAATGTTCAAACAGACAGCTCGACTTTGGGCACATGTGTATGCTGGAGCACCAGTTTCTAGTCCAGAATACACCAAAAAAATAGAAAACCTATGTGCTATGGGCTTTGATAGGAATGCAGTAATAGTGGCCTTGTCTTCAAAATCATGGGATGTAGAGACTGCAACAGAATTGCTTCTGAGTAACTGA

• Additionnal Information :

  Ubiquitin-conjugating enzyme E2 K isoform 1, Ubiquitin conjugating enzyme E2 K isoform 1, UBE2K, UBC1, UBC 1, LIG, HYPG, HIP2, E2-25K, E225K, E2 25K, ATGD0256-10 µg, ATGD0256-20 µg, ATGD0256-50 µg, ATGD0256-100 µg, ATGD0256-250 µg, ATGD0256-500 µg, ATGD0256-1 mg, ATGD0256-010, ATGD0256-020, ATGD0256-050, ATGD0256-100, ATGD0256-250, ATGD0256-500, ATGD0256-01M

• Storage Conditions :

  Store the plasmid at -20C.

• Formulation :

  Lyophilized

• Scientific Category :

  Ubiquitination

• Omim :

  602846

• NCBI Accession Number :

  NP_005330.1

• Species :

  Human

• Preparation :

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference :

  NM_005339.4

• DNA Size :

  603bp

• Vector Description :

  This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.