GABARAPL2 cDNA

• Description:

  Ubiquitin-like modifier involved in intra-Golgi traffic. Modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1 (By similarity) . Involved in autophagy. Plays a role in mitophagy which contributes to regulate mitochondrial quantity and quality by eliminating the mitochondria to a basal level to fulfill cellular energy requirements and preventing excess ROS production. Whereas LC3s are involved in elongation of the phagophore membrane, the GABARAP/GATE-16 subfamily is essential for a later stage in autophagosome maturation

• Product Name Alternative:

  Gamma-aminobutyric acid receptor-associated protein-like 2, GABA (A) receptor-associated protein-like 2, ATG8, ATG8C, GATE-16, GATE16, GEF2, FLC3A

• Chromosomal Location:

  16q22.1

• Antigen Species:

  Human

• Vector Type:

  PATGen (puc19-derived cloning vector)

• Sequence:

  ATGAAGTGGATGTTCAAGGAGGACCACTCGCTGGAACACAGATGCGTGGAGTCCGCGAAGATTCGAGCGAAATATCCCGACAGGGTTCCGGTGATTGTGGAAAAGGTCTCAGGCTCTCAGATTGTTGACATTGACAAACGGAAGTACTTGGTTCCATCTGATATCACTGTGGCTCAGTTCATGTGGATCATCAGGAAAAGGATCCAGCTTCCTTCTGAAAAGGCGATCTTCCTGTTTGTGGATAAGACAGTCCCACAGTCCAGCCTAACTATGGGACAGCTTTACGAGAAGGAAAAAGATGAAGATGGATTCTTATATGTGGCCTACAGCGGAGAGAACACTTTTGGCTTCTGA

• Additionnal Information:

  GEF-2, GEF2, GEF 2, GATE-16, GATE16, GATE 16, Gamma-aminobutyric acid receptor-associated protein-like 2, Gamma aminobutyric acid receptor associated protein like 2, GABARAPL2, GABA (A) receptor-associated protein-like 2, GABA (A) receptor associated protein like 2, GABA type A receptor associated protein like 2, FLC3A, ATG8C, ATG8, ATGD0253-10 µg, ATGD0253-20 µg, ATGD0253-50 µg, ATGD0253-100 µg, ATGD0253-250 µg, ATGD0253-500 µg, ATGD0253-1 mg, ATGD0253-010, ATGD0253-020, ATGD0253-050, ATGD0253-100, ATGD0253-250, ATGD0253-500, ATGD0253-01M

• Storage Conditions:

  Store the plasmid at -20C.

• Formulation:

  Lyophilized

• Scientific Category:

  Cancer

• Omim:

  607452

• NCBI Accession Number:

  NP_009216.1

• Species:

  Human

• Preparation:

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference:

  NM_007285.6

• DNA Size:

  354bp

• Vector Description:

  This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.