SCAND1 cDNA

• Description:

  SCAND1 encodes a SCAN box domain-containing protein. The SCAN domain is a highly conserved, leucine-rich motif of approximately 60 aa originally found within a subfamily of zinc finger proteins. This gene belongs to a family of genes that encode an isolated SCAN domain, but no zinc finger motif. This protein binds to and may regulate the function of the transcription factor myeloid zinc finger 1B. Alternate splicing results in multiple transcript variants.

• Product Name Alternative:

  RAZ1, SDP1

• Chromosomal Location:

  20q11.1-q11.23

• Antigen Species:

  Human

• Vector Type:

  PATGen (puc19-derived cloning vector)

• Sequence:

  ATGGCGGCTACGGAGCCGATCTTGGCGGCCACTGGGAGTCCCGCGGCGGTGCCACCGGAGAAACTGGAAGGAGCCGGTTCGAGCTCAGCCCCTGAGCGTAACTGTGTGGGCTCCTCGCTGCCAGAGGCCTCACCGCCTGCCCCTGAGCCTTCCAGTCCCAACGCCGCGGTCCCTGAAGCCATCCCTACGCCCCGAGCTGCGGCCTCCGCGGCCCTGGAGCTGCCTCTCGGGCCCGCACCCGTGAGCGTAGCGCCTCAGGCCGAAGCTGAAGCGCGCTCCACACCAGGCCCCGCCGGCTCTAGACTCGGTCCCGAGACGTTCCGCCAGCGTTTCCGGCAGTTCCGCTACCAGGATGCGGCGGGTCCCCGGGAGGCTTTCCGGCAGCTGCGGGAGCTGTCCCGCCAGTGGCTGCGGCCTGACATCCGCACCAAGGAGCAGATCGTGGAGATGCTGGTGCAAGAGCAGCTGCTCGCCATCCTGCCCGAGGCGGCTCGGGCCCGGCGGATCCGCCGCCGCACGGATGTGCGCATCACTGGCTGA

• Additionnal Information:

  SCAND1, RAZ1, SDP1, SCAND1, ATGD0161-10 µg, ATGD0161-20 µg, ATGD0161-50 µg, ATGD0161-100 µg, ATGD0161-250 µg, ATGD0161-500 µg, ATGD0161-1 mg, ATGD0161-10, ATGD0161-20, ATGD0161-50, ATGD0161-100, ATGD0161-250, ATGD0161-500, ATGD0161-1

• Storage Conditions:

  Store the plasmid at -20C.

• Formulation:

  Lyophilized

• Scientific Category:

  Epigenomics (Transcription & Translation)

• Omim:

  610416

• NCBI Accession Number:

  NP_057642.1

• Species:

  Human

• Preparation:

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference:

  NM_016558.3

• DNA Size:

  540bp

• Vector Description:

  This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.