TAGLN cDNA

• Description :

  TAGLN encoded by this gene is a transformation and shape-change sensitive actin cross-linking/gelling protein found in fibroblasts and smooth muscle. Its expression is down-regulated in many cell lines, and this down-regulation may be an early and sensitive marker for the onset of transformation. A functional role of this protein is unclear. Two transcript variants encoding the same protein have been found for this gene

• Product Name Alternative :

  WS3-10, Transgelin, TAGLN1, Smooth muscle protein 22-alpha, SMCC, SM22 alpha, SM22

• Chromosomal Location :

  11q23.2

• Antigen Species :

  Human

• Vector Type :

  PATGen (puc19-derived cloning vector)

• Sequence :

  ATGGCCAACAAGGGTCCTTCCTATGGCATGAGCCGCGAAGTGCAGTCCAAAATCGAGAAGAAGTATGACGAGGAGCTGGAGGAGCGGCTGGTGGAGTGGATCATAGTGCAGTGTGGCCCTGATGTGGGCCGCCCAGACCGTGGGCGCTTGGGCTTCCAGGTCTGGCTGAAGAATGGCGTGATTCTGAGCAAGCTGGTGAACAGCCTGTACCCTGATGGCTCCAAGCCGGTGAAGGTGCCCGAGAACCCACCCTCCATGGTCTTCAAGCAGATGGAGCAGGTGGCTCAGTTCCTGAAGGCGGCTGAGGACTATGGGGTCATCAAGACTGACATGTTCCAGACTGTTGACCTCTTTGAAGGCAAAGACATGGCAGCAGTGCAGAGGACCCTGATGGCTTTGGGCAGCTTGGCAGTGACCAAGAATGATGGGCACTACCGTGGAGATCCCAACTGGTTTATGAAGAAAGCGCAGGAGCATAAGAGGGAATTCACAGAGAGCCAGCTGCAGGAGGGAAAGCATGTCATTGGCCTTCAGATGGGCAGCAACAGAGGGGCCTCCCAGGCCGGCATGACAGGCTACGGACGACCTCGGCAGATCATCAGTTAG

• Additionnal Information :

  SM 22, SM22, SM22 alpha, SM22-alpha, SMCC, Smooth muscle protein 22 alpha, Smooth muscle protein 22-alpha, TAGLN, TAGLN 1, TAGLN1, TAGLN-1, Transgelin, WS3 10, WS310, WS3-10, ATGD0134-10 µg, ATGD0134-20 µg, ATGD0134-50 µg, ATGD0134-100 µg, ATGD0134-250 µg, ATGD0134-500 µg, ATGD0134-1 mg, ATGD0134-010, ATGD0134-020, ATGD0134-050, ATGD0134-100, ATGD0134-250, ATGD0134-500, ATGD0134-01M

• Storage Conditions :

  Store the plasmid at -20C.

• Formulation :

  Lyophilized

• Scientific Category :

  Cytoskeleton

• Omim :

  600818

• NCBI Accession Number :

  NP_001001522.1

• Species :

  Human

• Preparation :

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference :

  NM_001001522

• DNA Size :

  606bp

• Vector Description :

  This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.