Products for Research Use Only

PSME1 cDNA

CAT: 0112-ATGD0128-010Size: 10 µgDry Ice: NoHazardous: No
Product image 1
1 / 1
CAT#:0112-ATGD0128-010Size:10 µg
Selected
24/48H Stock Items & 2 to 6 Weeks non Stock Items.
Quick Request Actions
Description
The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the alpha subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three alpha and three beta subunits combine to form a heterohexameric ring. Alternative splicing results in multiple transcript variants.
Product Name Alternative
Proteasome activator subunit 1, 11S regulator complex subunit alpha, REG-alpha, Activator of multicatalytic protease subunit 1, Interferon gamma up-regulated I-5111 protein, IGUP I-5111, Proteasome activator 28 subunit alpha, PA28a, PA28alpha, IFI5111
Chromosomal Location
14q11.2
Antigen Species
Human
Vector Type
PATGen (puc19-derived cloning vector)
Sequence
ATGGCCATGCTCAGGGTCCAGCCCGAGGCCCAAGCCAAGGTGGATGTGTTTCGTGAAGACCTCTGTACCAAGACAGAGAACCTGCTCGGGAGCTATTTCCCCAAGAAGATTTCTGAGCTGGATGCATTTTTAAAGGAGCCAGCTCTCAATGAAGCCAACTTGAGCAATCTGAAGGCCCCATTGGACATCCCAGTGCCTGATCCAGTCAAGGAGAAAGAGAAAGAGGAGCGGAAGAAACAGCAGGAGAAGGAAGACAAGGATGAAAAGAAGAAGGGGGAGGATGAAGACAAAGGTCCTCCCTGTGGCCCAGTGAACTGCAATGAAAAGATCGTGGTCCTTCTGCAGCGCTTGAAGCCTGAGATCAAGGATGTCATTGAGCAGCTCAACCTGGTCACCACCTGGTTGCAGCTGCAGATACCTCGGATTGAGGATGGTAACAATTTTGGAGTGGCTGTCCAGGAGAAGGTGTTTGAGCTGATGACCAGCCTCCACACCAAGCTAGAAGGCTTCCACACTCAAATCTCTAAGTATTTCTCTGAGCGTGGTGATGCAGTGACTAAAGCAGCCAAGCAGCCCCATGTGGGTGATTATCGGCAGCTGGTGCACGAGCTGGATGAGGCAGAGTACCGGGACATCCGGCTGATGGTCATGGAGATCCGCAATGCTTATGCTGTGTTATATGACATCATCCTGAAGAACTTCGAGAAGCTCAAGAAGCCCAGGGGAGAAACAAAGGGAATGATCTATTGA
Additionnal Information
REG-alpha, REGalpha, PSME1, Proteasome activator subunit 1, Proteasome activator complex subunit 1, Proteasome activator 28 subunit alpha, PA28alpha, PA28a, PA28 Activator a Subunit, MGC8628, Interferon gamma up-regulated I-5111 protein, IGUP I-5111, IFI5111, Activator of multicatalytic protease subunit 1, 11S regulator complex subunit alpha, REG alpha, PA28 alpha, PA28 A, Interferon gamma up regulated I-5111 protein, Interferon gamma up regulated I5111 protein, ATGD0128-10 µg, ATGD0128-20 µg, ATGD0128-50 µg, ATGD0128-100 µg, ATGD0128-250 µg, ATGD0128-500 µg, ATGD0128-1 mg, ATGD0128-010, ATGD0128-020, ATGD0128-050, ATGD0128-100, ATGD0128-250, ATGD0128-500, ATGD0128-01M
Storage Conditions
Store the plasmid at -20C.
Formulation
Lyophilized
Scientific Category
Ubiquitination
Omim
600654
NCBI Accession Number
NP_006254.1
Species
Human
Preparation
1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.
RNA Reference
NM_006263.3
DNA Size
750bp
Vector Description
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.