NCBP2 cDNA

• Description :

  The product of NCBP2 is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein has an RNP domain commonly found in RNA binding proteins, and contains the cap-binding activity. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. Multiple transcript variants encoding different isoforms have been found for this gene.

• Product Name Alternative :

  CBC2, CBP20, NIP1, PIG55

• Chromosomal Location :

  3q29

• Antigen Species :

  Human

• Vector Type :

  PATGen (puc19-derived cloning vector)

• Sequence :

  ATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGACTCCTACGTGGAGCTGAGCCAGTACCGGGACCAGCACTTCCGGGGTGACAATGAAGAACAAGAAAAATTACTGAAGAAAAGCTGTACGTTATATGTTGGAAATCTTTCTTTTTACACAACTGAAGAACAAATCTATGAACTCTTCAGCAAAAGTGGTGACATAAAGAAAATCATTATGGGTCTGGATAAAATGAAGAAAACAGCATGTGGATTCTGTTTTGTGGAATATTACTCACGCGCAGATGCGGAAAACGCCATGCGGTACATAAATGGGACGCGTCTGGATGACCGAATCATTCGCACAGACTGGGACGCAGGCTTTAAGGAGGGCAGGCAATACGGCCGTGGGCGATCTGGGGGCCAGGTTCGGGATGAGTATCGGCAGGACTACGATGCTGGGAGAGGAGGCTATGGAAAACTGGCACAGAACCAGTGA

• Additionnal Information :

  NCBP2, CBC2, CBP20, NIP1, PIG55, NCBP2, ATGD0124-10 µg, ATGD0124-20 µg, ATGD0124-50 µg, ATGD0124-100 µg, ATGD0124-250 µg, ATGD0124-500 µg, ATGD0124-1 mg, ATGD0124-10, ATGD0124-20, ATGD0124-50, ATGD0124-100, ATGD0124-250, ATGD0124-500, ATGD0124-1

• Storage Conditions :

  Store the plasmid at -20C.

• Formulation :

  Lyophilized

• Scientific Category :

  Epigenomics (Transcription & Translation)

• Omim :

  65133

• NCBI Accession Number :

  NP_031388.2

• Species :

  Human

• Preparation :

  1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

• RNA Reference :

  NM_007362.3

• DNA Size :

  471bp

• Vector Description :

  This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.