ZNF3 cloning plasmid
-
Catalog numberCSB-CL026651HU3-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ZNF3 gene.
-
SpecificationsGene name: ZNF3; Gene ID: 7551; Accession number: BC008031; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 237; Sequence: atggtgtcctttagggctcttggagcagccagaccatgtttccaagagaaacctggtgatattgccagcagaccccctgccatcccccccagttgtcctggggctgaatgggcaaatctgtccaaacagctagtaaccggctgtgagggagagggtcagaagcacttagcgttggcctctgattgctgtcctctcttgtcctcttcccactccaatgatgaaaatgattttctctaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolZNF3
-
Short nameZNF3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namezinc finger protein 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetzinc finger protein 3, A8-51 and HF.12 and KOX25 and PP838 and Zfp113, ZNF3 and IDBG-30385 and ENSG00000166526 and 7551, metal ion binding, nuclei, Zfp113 and IDBG-205797 and ENSMUSG00000037007 and 56314, ZNF3 and IDBG-640736 and ENSBTAG00000007012 and 618141
-
Gene info
-
Identity
-
Gene
-
Long gene namezinc finger protein 3
-
Synonyms gene name
- zinc finger protein 3 (A8-51)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1989-05-31
-
Entrez gene record
-
RefSeq identity
-
Classification
- Zinc fingers C2H2-type
-
VEGA ID