XKR6 cloning plasmid

• Catalog number
  CSB-CL711015HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the XKR6 gene.
• Specifications
  Gene name: XKR6; Gene ID: 286046; Accession number: BC024146; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1089; Sequence: atgatgtatgaatatgcagacgtcaacatgctgcgcctcctggagaccttcctggagagcgcgccccaactggtgctacagctctacatcatgctccagaagaacagcgccgagaccctgccctgtgtctcctctgtgacttccctgatgtccctggcttgggtgctagcctcctatcacaagctgctgcgggactccagggacgacaagaagagcatgagctacagaggggccatcatccaggtcttctggcgcctcttcaccatctcatcccgagtgatctcttttgccctctttgcttccatcttccagctctattttgggatcttcgtggtggttcactggtgcgccatggccttctggatcatccatggcggaacagacttctgcatgtccaagtgggaggagatcctcttcaacatggtggtagggatcgtgtacattttctgctggtttaacgtcaaggaagggcggactcgatatcgaatgtttgcatattatacgatagtcttgaccgagaatgctgccttgacgttcctttggtatttttacagagacccggagaccactgactcctatgcggtgccagcactgtgttgtgtctttattagctttgtggctgggatcgcaatgatgctcttatactatggcgtgctgcatcccacaggaccacgagctaagatccttgccagctcctgttgtgccgagctgctctggggcatccctttgccccccgatgttgagcccatggcgcctgagatccctgggtaccgggggacccaggttacgcccaccagagccgtaacggaacaacaggaggatctcacggctgacacttgcttgcctgttttccaagtgagacccatggggccccctaccccgttggggcgtccttacctcccagaagggcccctcattaagattgacatgccaagaaagcgatacccagcttgggatgctcattttgtagacaggaggctgagaaggactattaacattctacaatatgtcacccccaccgcagtaggcattcgatatcgagacggaccactcctctatgagttgctacagtatgagtcttcactctaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  XKR6   cloning  
• Gene symbol
  XKR6
• Short name
  XKR6 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  X-linked Kx blood group (McLeod syndrome), Kell blood group complex subunit-related family, member 6 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  XK, Kell blood group complex subunit-related family, member 6, XKR6 and IDBG-7156 and ENSG00000171044 and 286046, Plasma membranes, Xkr6 and IDBG-172904 and ENSMUSG00000035067 and 219149, XKR6 and IDBG-629451 and ENSBTAG00000005396 and 539914

Gene info

• Identity
  HGNC:27806
• Gene
  XKR6
• Long gene name
  XK related 6
• Synonyms gene
  • C8orf7
  • C8orf21
  • C8orf5
• Synonyms gene name
  • chromosome 8 open reading frame 7
  • chromosome 8 open reading frame 21
  • X Kell blood group precursor-related family, member 6
  • chromosome 8 open reading frame 5
  • XK, Kell blood group complex subunit-related family, member 6
• GenBank acession
  • BC024146
• Locus
  8p23.1
• Discovery year
  2004-06-11
• Entrez gene record
  286046
• RefSeq identity
  • NM_173683
• Classification
  • MicroRNA protein coding host genes
  • XK related family
• VEGA ID
  OTTHUMG00000129351

Similar products