VEGFA cloning plasmid
-
Catalog numberCSB-CL025833HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the VEGFA gene.
-
SpecificationsGene name: VEGFA; Gene ID: 7422; Accession number: BC065522; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 444; Sequence: atgaactttctgctgtcttgggtgcattggagccttgccttgctgctctacctccaccatgccaagtggtcccaggctgcacccatggcagaaggaggagggcagaatcatcacgaagtggtgaagttcatggatgtctatcagcgcagctactgccatccaatcgagaccctggtggacatcttccaggagtaccctgatgagatcgagtacatcttcaagccatcctgtgtgcccctgatgcgatgcgggggctgctgcaatgacgagggcctggagtgtgtgcccactgaggagtccaacatcaccatgcagattatgcggatcaaacctcaccaaggccagcacataggagagatgagcttcctacagcacaacaaatgtgaatgcagaccaaagaaagatagagcaagacaagaaaaatgtgacaagccgaggcggtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolVEGFA
-
Short nameVEGFA cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namevascular endothelial growth factor A cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetvascular endothelial growth factor A, MVCD1 and VEGF and VPF, VEGFA and IDBG-88716 and ENSG00000112715 and 7422, extracellular matrix binding, Extracellular, Vegfa and IDBG-185847 and ENSMUSG00000023951 and 22339, VEGFA and IDBG-631944 and ENSBTAG00000047561 and 101904706
-
Gene info
-
Identity
-
Gene
-
Long gene namevascular endothelial growth factor A
-
Synonyms gene
-
Synonyms gene name
- vascular endothelial growth factor
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1994-01-10
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- VEGF family
-
VEGA ID
-
Locus Specific Databases