VCAN cloning plasmid
-
Catalog numberCSB-CL025810HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the VCAN gene.
-
SpecificationsGene name: VCAN; Gene ID: 1462; Accession number: BC050524; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 1065; Sequence: atgttcataaatataaagagcatcttatggatgtgttcaaccttaatagtaacccatgcgctacataaagtcaaagtgggaaaaagcccaccggtgaggggctccctctctggaaaagtcagcctaccttgtcatttttcaacgatgcctactttgccacccagttacaacaccagtgaatttctccgcatcaaatggtctaagattgaagtggacaaaaatggaaaagatttgaaagagactactgtccttgtggcccaaaatggaaatatcaagattggtcaggactacaaagggagagtgtctgtgcccacacatcccgaggctgtgggcgatgcctccctcactgtggtcaagctgctggcaagtgatgcgggtctttaccgctgtgacgtcatgtacgggattgaagacacacaagacacggtgtcactgactgtggatggggttgtgtttcactacagggcggcaaccagcaggtacacactgaattttgaggctgctcagaaggcttgtttggacgttggggcagtcatagcaactccagagcagctctttgctgcctatgaagatggatttgagcagtgtgacgcaggctggctggctgatcagactgtcagatatcccatccgggctcccagagtaggctgttatggagataagatgggaaaggcaggagtcaggacttatggattccgttctccccaggaaacttacgatgtgtattgttatgtggatcatctggatggtgatgtgttccacctcactgtccccagtaaattcaccttcgaggaggctgcaaaagagtgtgaaaaccaggatgccaggctggcaacagtgggggaactccaggcggcatggaggaacggctttgaccagtgcgattacgggtggctgtcggatgccagcgtgcgccaccctgtgactgtggccagggcccagtgtggaggtggtctacttggggtgagaaccctgtatcgttttgagaaccagacaggcttccctccccctgatagcagatttgatgcctactgctttaaacgtaagtgtttgatacctttttaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolVCAN-AS1, VCAN
-
Short nameVCAN cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameversican cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetversican, CSPG2 and ERVR and GHAP and PG-M and WGN and WGN1, VCAN and IDBG-32298 and ENSG00000038427 and 1462, carbohydrate binding, Extracellular, Vcan and IDBG-170883 and ENSMUSG00000021614 and 13003, VCAN and IDBG-646522 and ENSBTAG00000014906 and 101909176,282662
-
Gene info
-
Identity
-
Gene
-
Long gene nameVCAN antisense RNA 1
-
Synonyms gene name
- VCAN antisense RNA 1 (non-protein coding)
-
Locus
-
Discovery year2011-08-23
-
Entrez gene record
-
Classification
- Antisense RNAs
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameversican
-
Synonyms gene
-
Synonyms gene name
- chondroitin sulfate proteoglycan 2
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1991-07-18
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- C-type lectin domain containing
- Sushi domain containing
- Hyalectan proteoglycans
- V-set domain containing
-
VEGA ID