UTP11L cloning plasmid

• Catalog number
  CSB-CL897542HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the UTP11L gene.
• Specifications
  Gene name: UTP11L; Gene ID: 51118; Accession number: BC005182; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 762; Sequence: atggcggcggcttttcggaaggcggctaagtcccggcagcgggaacacagagagcgaagccagcctggctttcgaaaacatctgggcctgctggagaaaaagaaagattacaaacttcgtgcagatgactaccgtaaaaaacaagaatacctcaaagctcttcggaagaaggctcttgaaaaaaatccagatgaattctactacaaaatgactcgggttaaactccaggatggagtacatattattaaggagactaaggaagaagtaaccccagaacaactaaagctgatgagaactcaggacgtcaaatatatagaaatgaagagggttgcagaagctaagaaaatcgaaagactaaaatcagagctccatctgctggatttccaggggaagcaacagaacaagcatgtgttcttttttgacaccaaaaaggaagttgaacagtttgatgtcgcaactcacctgcaaacagccccggagctagtcgacagagtctttaataggcccaggatagagaccttgcagaaagaaaaagtgaaaggagttaccaatcagactggacttaagcggatagctaaagaaaggcaaaagcagtataactgcctgacacagcggattgaacgagagaagaaattgttcgttattgctcagaaaattcaaacacgcaaagatcttatggataaaactcagaaagtgaaggtgaagaaagaaacggtgaactccccagctatttataaatttcagagtcgtcgaaaacgttga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  UTP11L   cloning  
• Gene symbol
  UTP11
• Short name
  UTP11L cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast), UTP11L and IDBG-96558 and ENSG00000183520 and 51118, poly(A) RNA binding, nuclei, Utp11l and IDBG-186561 and ENSMUSG00000028907 and 67205, UTP11L and IDBG-641036 and ENSBTAG00000002306 and 537675

Gene info

• Identity
  HGNC:24329
• Gene
  UTP11
• Long gene name
  UTP11 small subunit processome component
• Synonyms gene
  • UTP11L
• Synonyms gene name
  • UTP11-like, U3 small nucleolar ribonucleoprotein (yeast)
• Synonyms
  • CGI-94
• GenBank acession
  • AF151852
• Locus
  1p34.3
• Discovery year
  2005-06-22
• Entrez gene record
  51118
• Pubmed identfication
  • 11860508
  • 10810093
• RefSeq identity
  • NM_016037
• Classification
  • SSU processome
• VEGA ID
  OTTHUMG00000004435

Similar products