TNFSF18 cloning plasmid
-
Catalog numberCSB-CL891791HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TNFSF18 gene.
-
SpecificationsGene name: TNFSF18; Gene ID: 8995; Accession number: BC069319; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 534; Sequence: atgtgtttgagccacttggaaaatatgcctttaagccattcaagaactcaaggagctcagagatcatcctggaagctgtggctcttttgctcaatagttatgttgctatttctttgctccttcagttggctaatctttatttttctccaattagagactgctaaggagccctgtatggctaagtttggaccattaccctcaaaatggcaaatggcatcttctgaacctccttgcgtgaataaggtgtctgactggaagctggagatacttcagaatggcttatatttaatttatggccaagtggctcccaatgcaaactacaatgatgtagctccttttgaggtgcggctgtataaaaacaaagacatgatacaaactctaacaaacaaatctaaaatccaaaatgtaggagggacttatgaattgcatgttggggacaccatagacttgatattcaactctgagcatcaggttctaaaaaataatacatactggggtatcattttactagcaaatccccaattcatctcctag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTNFSF18
-
Short nameTNFSF18 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nametumor necrosis factor (ligand) superfamily, member 18 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targettumor necrosis factor (ligand) superfamily, member 18, AITRL and GITRL and hGITRL and TL6, TNFSF18 and IDBG-104861 and ENSG00000120337 and 8995, tumor necrosis factor receptor superfamily binding, Extracellular, Tnfsf18 and IDBG-201543 and ENSMUSG00000066755 and 240873, LOC768081 and IDBG-632315 and ENSBTAG00000047412 and 768081
-
Gene info
-
Identity
-
Gene
-
Long gene nameTNF superfamily member 18
-
Synonyms gene name
- tumor necrosis factor (ligand) superfamily, member 18
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1999-01-15
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Tumor necrosis factor superfamily
-
VEGA ID