TNFRSF21 cloning plasmid

  • Catalog number
    CSB-CL023979HU3-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the TNFRSF21 gene.
  • Specifications
    Gene name: TNFRSF21; Gene ID: 27242; Accession number: BC005192; Vector: pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 375; Sequence: atgcaattcaactttgagttatcttttaaatatgtcttgtatagttcatattcatggctgaaacttgaccacactattgctgattgtatggttttcacctggacaccgtgtagaatgcttgattacttgtactcttcttatgctaatatgctctgggctggagaaatgaaatcctcaagccatcaggatttgctatttaagtggcttgacaactgggccaccaaagaacttgaacttcaccttttaggatttgagctgttctggaacacattgctgcactttggaaagtcaaaatcaagtgccagtggcgccctttccatagagaatttgcccagctttgctttaaaagatgtcttgttttttatatacacataa
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
  • Gene symbol
    TNFRSF21
  • Short name
    TNFRSF21 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    tumor necrosis factor receptor superfamily, member 21 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    tumor necrosis factor receptor superfamily, member 21, TNFRSF21 and IDBG-90063 and ENSG00000146072 and 27242, protein binding, Plasma membranes, Tnfrsf21 and IDBG-184035 and ENSMUSG00000023915 and 94185, TNFRSF21 and IDBG-632394 and ENSBTAG00000020054 and 537922
Gene info
Similar products
Filters
Contact
Chat with gentaur.com employee