TNFRSF21 cloning plasmid
-
Catalog numberCSB-CL023979HU3-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TNFRSF21 gene.
-
SpecificationsGene name: TNFRSF21; Gene ID: 27242; Accession number: BC005192; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 375; Sequence: atgcaattcaactttgagttatcttttaaatatgtcttgtatagttcatattcatggctgaaacttgaccacactattgctgattgtatggttttcacctggacaccgtgtagaatgcttgattacttgtactcttcttatgctaatatgctctgggctggagaaatgaaatcctcaagccatcaggatttgctatttaagtggcttgacaactgggccaccaaagaacttgaacttcaccttttaggatttgagctgttctggaacacattgctgcactttggaaagtcaaaatcaagtgccagtggcgccctttccatagagaatttgcccagctttgctttaaaagatgtcttgttttttatatacacataa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTNFRSF21
-
Short nameTNFRSF21 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nametumor necrosis factor receptor superfamily, member 21 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targettumor necrosis factor receptor superfamily, member 21, TNFRSF21 and IDBG-90063 and ENSG00000146072 and 27242, protein binding, Plasma membranes, Tnfrsf21 and IDBG-184035 and ENSMUSG00000023915 and 94185, TNFRSF21 and IDBG-632394 and ENSBTAG00000020054 and 537922
-
Gene info
-
Identity
-
Gene
-
Long gene nameTNF receptor superfamily member 21
-
Synonyms gene name
- tumor necrosis factor receptor superfamily, member 21
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2001-07-27
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Tumor necrosis factor receptor superfamily
- CD molecules
-
VEGA ID