TNFAIP3 cloning plasmid

  • Catalog number
    CSB-CL023958HU1-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the TNFAIP3 gene.
  • Specifications
    Gene name: TNFAIP3; Gene ID: 7128; Accession number: BC064689; Vector: pENTR223.1
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 747; Sequence: atggctgaacaagtccttcctcaggctttgtatttgagcaatatgcggaaagctgtgaagatacgggagagaactccagaagacatttttaaacctactaatgggatcattcatcattttaaaaccatgcaccgatacacactggaaatgttcagaacttgccagttttgtcctcagtttcgggagatcatccacaaagccctcatcgacagaaacatccaggccaccctggaaagccagaagaaactcaactggtgtcgagaagtccggaagcttgtggcgctgaaaacgaacggtgacggcaattgcctcatgcatgccacttctcagtacatgtggggcgttcaggacacagacttggtactgaggaaggcgctgttcagcacgctcaaggaaacagacacacgcaactttaaattccgctggcaactggagtctctcaaatctcaggaatttgttgaaacggggctttgctatgatactcggaactggaatgatgaatgggacaatcttatcaaaatggcttccacagacacacccatggcccgaagtggacttcagtacaactcactggaagaaatacacatatttgtcctttgcaacatcctcagaaggccaatcattgtcatttcaggtgagatgcctgcagatcacggatctgtacttaaatgctttcagccttatgccttggctcctggagaaaaccacactgccaaagttcaggtaacagagttcaatggaatttga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
  • Gene symbol
    TNFAIP3, WAKMAR2
  • Short name
    TNFAIP3 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    tumor necrosis factor, a-induced protein 3 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    tumor necrosis factor, alpha-induced protein 3, A20 and OTUD7C and TNFA1P2, TNFAIP3 and IDBG-97033 and ENSG00000118503 and 7128, protein self-association, nuclei, Tnfaip3 and IDBG-135792 and ENSMUSG00000019850 and 21929, TNFAIP3 and IDBG-633691 and ENSBTAG00000000436 and 508105
Gene info
  • Identity
  • Gene
  • Long gene name
    TNF alpha induced protein 3
  • Synonyms gene name
    • tumor necrosis factor, alpha-induced protein 3
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    1992-10-20
  • Entrez gene record
  • Pubmed identfication
  • Classification
    • OTU domain containing
  • VEGA ID
Gene info
Similar products
Filters
Contact
Chat with gentaur.com employee