TNFAIP3 cloning plasmid
-
Catalog numberCSB-CL023958HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TNFAIP3 gene.
-
SpecificationsGene name: TNFAIP3; Gene ID: 7128; Accession number: BC064689; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 747; Sequence: atggctgaacaagtccttcctcaggctttgtatttgagcaatatgcggaaagctgtgaagatacgggagagaactccagaagacatttttaaacctactaatgggatcattcatcattttaaaaccatgcaccgatacacactggaaatgttcagaacttgccagttttgtcctcagtttcgggagatcatccacaaagccctcatcgacagaaacatccaggccaccctggaaagccagaagaaactcaactggtgtcgagaagtccggaagcttgtggcgctgaaaacgaacggtgacggcaattgcctcatgcatgccacttctcagtacatgtggggcgttcaggacacagacttggtactgaggaaggcgctgttcagcacgctcaaggaaacagacacacgcaactttaaattccgctggcaactggagtctctcaaatctcaggaatttgttgaaacggggctttgctatgatactcggaactggaatgatgaatgggacaatcttatcaaaatggcttccacagacacacccatggcccgaagtggacttcagtacaactcactggaagaaatacacatatttgtcctttgcaacatcctcagaaggccaatcattgtcatttcaggtgagatgcctgcagatcacggatctgtacttaaatgctttcagccttatgccttggctcctggagaaaaccacactgccaaagttcaggtaacagagttcaatggaatttga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTNFAIP3, WAKMAR2
-
Short nameTNFAIP3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nametumor necrosis factor, a-induced protein 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targettumor necrosis factor, alpha-induced protein 3, A20 and OTUD7C and TNFA1P2, TNFAIP3 and IDBG-97033 and ENSG00000118503 and 7128, protein self-association, nuclei, Tnfaip3 and IDBG-135792 and ENSMUSG00000019850 and 21929, TNFAIP3 and IDBG-633691 and ENSBTAG00000000436 and 508105
-
Gene info
-
Identity
-
Gene
-
Long gene nameTNF alpha induced protein 3
-
Synonyms gene name
- tumor necrosis factor, alpha-induced protein 3
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1992-10-20
-
Entrez gene record
-
Pubmed identfication
-
Classification
- OTU domain containing
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene namewound and keratinocyte migration associated lncRNA 2
-
Synonyms
-
Locus
-
Discovery year2019-05-31
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Long non-coding RNAs with non-systematic symbols