TINAG cloning plasmid
-
Catalog numberCSB-CL023564HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TINAG gene.
-
SpecificationsGene name: TINAG; Gene ID: 27283; Accession number: BC056235; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 423; Sequence: atgtggaccggatataagatcttaatcttctcttatcttactacagaaatctggatggagaagcagtatttatctcaaagagaagtggacctagaggcttatttcactaggaatcacaccgttttgcaaggtactcgattcaaaagagccattttccaagggcaatactgtagaaattttggctgttgtgaagacagagatgatggctgtgtcactgagttctatgcggcgaatgcgttgtgctactgtgataaattctgtgacagagaaaattctgattgctgtcctgactacaagtccttttgccgtgaagagaaagaatggcctcctcacacacagccttggtatccagaaggttgcttcaaagatggtcaacattatgaagagggatcagtaattaaagaaaactgcaactcctggtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTINAG, TINAG-AS1
-
Short nameTINAG cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nametubulointerstitial nephritis antigen cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targettubulointerstitial nephritis antigen, TINAG and IDBG-91109 and ENSG00000137251 and 27283, polysaccharide binding, multiple, Tinag and IDBG-185797 and ENSMUSG00000032357 and 26944, TINAG and IDBG-628721 and ENSBTAG00000012652 and 512517
-
Gene info
-
Identity
-
Gene
-
Long gene nametubulointerstitial nephritis antigen
-
GenBank acession
-
Locus
-
Discovery year2001-04-05
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Peptidase family C1
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameTINAG antisense RNA 1
-
Locus
-
Discovery year2020-03-30
-
Entrez gene record
-
Classification
- Antisense RNAs