TESC cloning plasmid
-
Catalog numberCSB-CL023393HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TESC gene.
-
SpecificationsGene name: TESC; Gene ID: 54997; Accession number: BC015221; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 645; Sequence: atgggcgctgcccactccgcgtctgaggaggtgcgggagctcgagggcaagaccggcttctcatcggatcagatcgagcagctccatcggagatttaagcagctgagtggagatcagcctaccattcgcaaggagaacttcaacaatgtcccggacctggagctcaaccccatccgatccaaaattgttcgtgccttcttcgacaacaggaacctgcgcaagggacccagtggcctggctgatgagatcaatttcgaggacttcctgaccatcatgtcctacttccggcccatcgacaccaccatggacgaggaacaggtggagctgtcccggaaggagaagctgagatttctgttccacatgtacgactcggacagcgacggccgcatcactctggaagaatatcgaaatgtggtcgaggagctgctgtcgggaaaccctcacatcgagaaggagtccgctcgctccatcgccgacggggccatgatggaggcggccagcgtgtgcatggggcagatggagcctgatcaggtgtacgaggggatcaccttcgaggacttcctgaagatctggcaggggatcgacattgagaccaagatgcacgtccgcttccttaacatggaaaccatggccctctgccactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTESC-AS1, TESC
-
Short nameTESC cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nametescalcin cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targettescalcin, TESC and IDBG-59389 and ENSG00000088992 and 54997, protein homodimerization activity, nuclei, Tesc and IDBG-195050 and ENSMUSG00000029359 and 57816, TESC and IDBG-633593 and ENSBTAG00000044078 and 787094
-
Gene info
-
Identity
-
Gene
-
Long gene nameTESC antisense RNA 1 (head to head)
-
Locus
-
Discovery year2014-07-30
-
Entrez gene record
-
Classification
- Antisense RNAs
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nametescalcin
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2006-02-07
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- EF-hand domain containing
-
VEGA ID