TCTA cloning plasmid

• Catalog number
  CSB-CL023331HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the TCTA gene.
• Specifications
  Gene name: TCTA; Gene ID: 6988; Accession number: BC005157; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 312; Sequence: atggcggagtcctggtctgggcaggccttgcaggctctgccggccacggtgctgggcgcgctgggcagcgagttcttgcgggagtgggaggcgcaggacatgcgcgtgaccctcttcaagctgctgctgctgtggttggtgttaagtctcctgggcatccagctggcgtgggggttctacgggaatacagtgaccgggttgtatcaccgtccaggtctgggtggtcagaatggatccacgcctgatggctccacgcatttcccttcgtgggaaatggcagcaaacgaacctctcaaaacccacagagaataa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  TCTA   cloning  
• Gene symbol
  TCTA
• Short name
  TCTA cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  T-cellular leukemia translocation altered cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  T-cell leukemia translocation altered, TCTA and IDBG-34809 and ENSG00000145022 and 6988, Plasma membranes, Tcta and IDBG-199611 and ENSMUSG00000039461 and 102791, TCTA and IDBG-645992 and ENSBTAG00000022632 and 616169

Gene info

• Identity
  HGNC:11692
• Gene
  TCTA
• Long gene name
  T cell leukemia translocation altered
• Synonyms gene name
  • T-cell leukemia translocation altered gene
  • T-cell leukemia translocation altered
• Locus
  3p21.31
• Discovery year
  1995-08-11
• Entrez gene record
  6988
• Pubmed identfication
  • 7728759
• RefSeq identity
  • NM_022171
• VEGA ID
  OTTHUMG00000156846

Similar products