SPATA3 cloning plasmid
-
Catalog numberCSB-CL847751HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the SPATA3 gene.
-
SpecificationsGene name: SPATA3; Gene ID: 130560; Accession number: BC047704; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 552; Sequence: atgaagaaggtcaagaagaaaaggtcagaggccagacgccaccgagactccacctcccagcatgctagctccaattccacctctcagcagcctagtcctgaatccacaccacagcagcctagccctgaatccacaccacagcattccagccttgaaaccacctcccggcagccagcattccaagcccttccagcacccgaaatccgccgctcctcttgctgccttttatctccagatgctaacgtgaaggcagcccctcaatccaggaaagcagggcctctgactcgcgccggcccgcattcctgctcctgtgccacttgcccctgcagctccgcttgctggcgtcgtctggggctatgccatagccgcatcttcgatgtccttctgcctcgggactggcagatggcgccagggagaggactccccaacctgctcaccttctacagaaaatcttcaagaaaaccctccagtcatcgtaacgcgtgtcctccaagccctcggaactgtggctgtggctctgggggctctaggagctgcctactacatcactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolSPATA3, SPATA3-AS1
-
Short nameSPATA3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namespermatogenesis associated 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetspermatogenesis associated 3, SPATA3 and IDBG-83004 and ENSG00000173699 and 130560, molecular_function, multiple, Spata3 and IDBG-176358 and ENSMUSG00000026226 and 70060, SPATA3 and IDBG-644363 and ENSBTAG00000030718 and 617853
-
Gene info
-
Identity
-
Gene
-
Long gene namespermatogenesis associated 3
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2002-01-25
-
Entrez gene record
-
RefSeq identity
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameSPATA3 antisense RNA 1 (head to head)
-
Locus
-
Discovery year2013-10-14
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Antisense RNAs
-
VEGA ID