SOCS4 cloning plasmid

  • Catalog number
    CSB-CL022393HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the SOCS4 gene.
  • Specifications
    Gene name: SOCS4; Gene ID: 122809; Accession number: BC060790; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1323; Sequence: atggcagaaaataatgaaaatattagtaaaaatgtagatgtaaggcccaaaactagtcggagcagaagtgccgacagaaaagacggttatgtgtggagtggaaagaagttatcttggtcaaaaaagagtgagagttattcagatgctgagacagtgaatggtatagagaaaaccgaagtgtctttaaggaaccaagaaaggaagcacagctgttcatccattgagttggacttagatcattcctgtgggcatcgatttttaggccgatctcttaaacagaaactgcaagatgccgtggggcagtgttttccaataaagaattgtagtagtcggcactcttcagggcttccgtctaaaaggaaaattcatatcagtgaactcatgttagataagtgtcctttcccacctcgatcagatttagcctttaggtggcattttattaaacgacacactgctcctataaattccaaatcagatgaatgggtaagcacagacttgtctcagactgaattgagggatggtcagctaaaacgaagaaatatggaagaaaatataaactgtttctcacataccaatgttcagccctgtgtcataaccaccgacaatgctttgtgtagagaaggtcctatgactggctctgtgatgaacctggtttcaaataacagtatagaagatagtgatatggattccgatgatgaaattctaacactttgcacaagttccagaaaaagaaacaaacccaaatgggatttggatgatgaaatcctgcagttggaaacacctcctaaataccacacgcagattgattatgtccactgtcttgtaccagacctccttcagatcaataacaacccatgttactggggagtgatggataaatacgcagccgaagcactactggaaggaaaaccagagggtacctttttacttcgagactcagcacaggaagactatttattctctgttagttttagacgctatagtcgttctcttcatgctagaattgaacagtggaatcacaactttagctttgatgcacatgacccctgtgtcttccattctcctgacattactgggctcctagaacattataaggacccaagcgcctgtatgttctttgaaccacttctatccactcccttaattcggactttccctttttccctgcagcatatatgcagaacagttatttgtaactgtacaacttatgatggcatcgatgcccttccaattccttcttctatgaaattatatctgaaggaatatcattataaatcaaaagttagagtactcaggattgatgcaccagaacagcaatgctag
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    SOCS4   cloning  
  • Gene symbol
    SOCS4, SOCS6
  • Short name
    SOCS4 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    suppressor on cytokine signaling 4 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    suppressor of cytokine signaling 4, SOCS4 and IDBG-7209 and ENSG00000180008 and 122809, multiple, Socs4 and IDBG-154333 and ENSMUSG00000048379 and 67296, SOCS4 and IDBG-646714 and ENSBTAG00000021988 and 540412
Gene info
  • Identity
  • Gene
  • Long gene name
    suppressor of cytokine signaling 4
  • Synonyms gene
  • Synonyms gene name
    • suppressor of cytokine signaling 7
  • GenBank acession
  • Locus
  • Discovery year
    2002-11-11
  • Entrez gene record
  • Pubmed identfication
  • Classification
    • Suppressors of cytokine signaling
    • SH2 domain containing
  • VEGA ID
Gene info
Similar products
Filters
Contact
Chat with gentaur.com employee