SMAD9 cloning plasmid

  • Catalog number
    CSB-CL021794HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the SMAD9 gene.
  • Specifications
    Gene name: SMAD9; Gene ID: 4093; Accession number: BC011559; Vector: pENTR223.1
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1293; Sequence: atgcactccaccacccccatcagctccctcttctccttcaccagccccgcagtgaagagactgctaggctggaagcaaggagatgaagaggaaaagtgggcagagaaggcagtggactctctagtgaagaagttaaagaagaagaagggagccatggacgagctggagagggctctcagctgcccggggcagcccagcaaatgcgtcacgattccccgctccctggacgggcggctgcaggtgtcccaccgcaagggcctgccccatgtgatttactgtcgcgtgtggcgctggccggatctgcagtcccaccacgagctgaagccgctggagtgctgtgagttcccatttggctccaagcagaaagaagtgtgcattaacccttaccactaccgccgggtggagactccagtactgcctcctgtgctcgtgccaagacacagtgaatataacccccagctcagcctcctggccaagttccgcagcgcctccctgcacagtgagccactcatgccacacaacgccacctatcctgactctttccagcagcctccgtgctctgcactccctccctcacccagccacgcgttctcccagtccccgtgcacggccagctaccctcactccccaggaagtccttctgagccagagagtccctatcaacactcagactttcgaccagtttgttacgaggagccccagcactggtgctcggtcgcctactatgaactgaacaaccgagttggggagacattccaggcttcctcccgaagtgtgctcatagatgggttcaccgacccttcaaataacaggaacagattctgtcttggacttctttctaatgtaaacagaaactcaacgatagaaaataccaggagacatataggaaagggtgtgcacttgtactacgtcgggggagaggtgtatgccgagtgcgtgagtgacagcagcatctttgtgcagagccggaactgcaactatcaacacggcttccacccagctaccgtctgcaagatccccagcggctgcagcctcaaggtcttcaacaaccagctcttcgctcagctcctggcccagtcagttcaccacggctttgaagtcgtgtatgaactgaccaagatgtgtactatccggatgagttttgttaagggttggggtgctgagtatcatcgccaggatgtcaccagcaccccctgctggattgagattcatcttcatgggccactgcagtggctggacaaagttctgactcagatgggctctccacataaccccatttcttcagtgtcttaa
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    SMAD9   cloning  
  • Gene symbol
    SMAD9-IT1, SMAD9
  • Short name
    SMAD9 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    SMAD family member 9 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    SMAD family member 9, MADH6 and MADH9 and PPH2 and SMAD8 and SMAD8A and SMAD8B, SMAD9 and IDBG-24637 and ENSG00000120693 and 4093, transforming growth factor beta receptor, nuclei, Smad9 and IDBG-144967 and ENSMUSG00000027796 and 55994, BT.61870 and IDBG-629870 and ENSBTAG00000007589 and 540806
Gene info
  • Identity
  • Gene
  • Long gene name
    SMAD9 intronic transcript 1
  • Synonyms gene
  • Synonyms gene name
    • SMAD9 antisense RNA 1 (non-protein coding)
    • SMAD9 antisense RNA 1
  • Locus
  • Discovery year
    2011-04-18
  • Classification
    • Intronic transcripts
  • VEGA ID
Gene info
  • Identity
  • Gene
  • Long gene name
    SMAD family member 9
  • Synonyms gene
  • Synonyms gene name
    • MAD, mothers against decapentaplegic homolog 9 (Drosophila)
    • SMAD, mothers against DPP homolog 9 (Drosophila)
  • Synonyms
  • Locus
  • Discovery year
    1997-07-25
  • Entrez gene record
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • SMAD family
  • VEGA ID
  • Locus Specific Databases
Similar products
Filters
Contact
Chat with gentaur.com employee