SLAMF1 cloning plasmid
-
Catalog numberCSB-CL614403HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the SLAMF1 gene.
-
SpecificationsGene name: SLAMF1; Gene ID: 6504; Accession number: BC067847; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 447; Sequence: atggatcccaaggggctcctctccttgaccttcgtgctgtttctctccctggcttttggggcaagctacggaacaggtgggcgcatgatgaactgcccaaagattctccggcagttgggaagcaaagtgctgctgcccctgacatatgaaaggataaataagagcatgaacaaaagcatccacattgtcgtcacaatggcaaaatcactggagaacagtgtcgagaacaaaatagtgtctcttgatccatccgaagcaggccctccacgttatctaggagatcgctacaagttttatctggagaatctcaccctggggatacgggaaagcaggaaggaggatgagggatggtaccttatgaccctggagaaaaatgtttcagttcagcgcttttgcctgcagttgaggctttatggtaataatggcggcttccccagtccacactaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolSLAMF1
-
Short nameSLAMF1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namesignaling lymphocytic activation molecule family member 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetsignaling lymphocytic activation molecule family member 1, CD150 and CDw150 and SLAM, SLAMF1 and IDBG-104073 and ENSG00000117090 and 6504, protein binding, Cell surfaces, Slamf1 and IDBG-204832 and ENSMUSG00000015316 and 27218, SLAMF1 and IDBG-630529 and ENSBTAG00000007927 and 281489
-
Gene info
-
Identity
-
Gene
-
Long gene namesignaling lymphocytic activation molecule family member 1
-
Synonyms gene
-
Synonyms gene name
- signaling lymphocytic activation molecule
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1998-08-06
-
Entrez gene record
-
Pubmed identfication
-
Classification
- CD molecules
- Immunoglobulin like domain containing
- Ig-like cell adhesion molecule family
-
VEGA ID