SHISA5 cloning plasmid
-
Catalog numberCSB-CL818677HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the SHISA5 gene.
-
SpecificationsGene name: SHISA5; Gene ID: 51246; Accession number: BC001463; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 414; Sequence: atggggttcggagcgaccttggccgttggcctgaccatctttgtgctgtctgtcgtcactatcatcatctgcttcacctgctcctgctgctgcctttacaagacgtgccgccgaccacgtccggttgtcaccaccaccacatccaccactgtggtgcatgccccttatcctcagcctccaagtgtgccgcccagctaccctggaccaagctaccagggctaccacaccatgccgcctcagccagggatgccagcagcaccctacccaatgcagtacccaccaccttacccagcccagcccatgggcccaccggcctaccacgagaccctggctggaggagcagccgcgccctaccccgccagccagcctccttacaacccggcctacatggatgccccgaaggcggccctctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolSHISA5
-
Short nameSHISA5 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameshisa homolog 5 (Xenopus laevis) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetshisa homolog 5 (Xenopus laevis), SHISA5 and IDBG-32953 and ENSG00000164054 and 51246, WW domain binding, nuclei, Shisa5 and IDBG-201052 and ENSMUSG00000025647 and 66940, SHISA5 and IDBG-646132 and ENSBTAG00000009183 and 100335346,616861
-
Gene info
-
Identity
-
Gene
-
Long gene nameshisa family member 5
-
Synonyms gene name
- shisa homolog 5 (Xenopus laevis)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2008-04-01
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Shisa family members
-
VEGA ID