SH2D1A cloning plasmid

• Catalog number
  CSB-CL021209HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the SH2D1A gene.
• Specifications
  Gene name: SH2D1A; Gene ID: 4068; Accession number: BC020732; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 387; Sequence: atggacgcagtggctgtgtatcatggcaaaatcagcagggaaaccggcgagaagctcctgcttgccactgggctggatggcagctatttgctgagggacagcgagagcgtgccaggcgtgtactgcctatgtgtgctgtatcacggttacatttatacataccgagtgtcccagacagaaacaggttcttggagtgctgagacagcacctggggtacataaaagatatttccggaaaataaaaaatctcatttcagcatttcagaagccagatcaaggcattgtaatacctctgcagtatccagttgagaagaagtcctcagctagaagtacacaaggtactacagggataagagaagatcctgatgtctgcctgaaagccccatga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  SH2D1A   cloning  
• Gene symbol
  SH2D1A
• Short name
  SH2D1A cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  SH2 domain containing 1A cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  SH2 domain containing 1A, DSHP and EBVS and IMD5 and LYP and MTCP1 and SAP and SAP/SH2D1A and XLP and XLPD and XLPD1, SH2D1A and IDBG-85368 and ENSG00000183918 and 4068, protein binding, Cytoplasm, Sh2d1a and IDBG-141610 and ENSMUSG00000005696 and 20400, SH2D1A and IDBG-630222 and ENSBTAG00000026067 and 613356

Gene info

• Identity
  HGNC:10820
• Gene
  SH2D1A
• Long gene name
  SH2 domain containing 1A
• Synonyms gene
  • IMD5
  • LYP
• Synonyms gene name
  • lymphoproliferative syndrome
  • SH2 domain protein 1A
• Synonyms
  • XLP
  • MTCP1
  • DSHP
  • XLPD
  • EBVS
  • SAP
• Synonyms name
  • Duncan's disease
• GenBank acession
  • AL023657
• Locus
  Xq25
• Discovery year
  1989-06-30
• Entrez gene record
  4068
• Pubmed identfication
  • 9771704
  • 9774102
• RefSeq identity
  • NM_002351
• Classification
  • SH2 domain containing
• VEGA ID
  OTTHUMG00000022344
• Locus Specific Databases
  • SH2D1Abase: Mutation registry for X-linked lymphoproliferative syndrome (XLP)
  • LRG_106

MeSH Data

• Name
  Electrophoresis, Gel, Two-Dimensional
• Concept
  Scope note: Electrophoresis in which a second perpendicular electrophoretic transport is performed on the separate components resulting from the first electrophoresis. This technique is usually performed on polyacrylamide gels.
• Tree numbers
  • E05.196.401.250
  • E05.301.300.230
• Qualifiers
  ethics, trends, veterinary, history, classification, economics, instrumentation, methods, standards, statistics & numerical data

Similar products