S100A8 cloning plasmid

• Catalog number
  CSB-CL020641HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the S100A8 gene.
• Specifications
  Gene name: S100A8; Gene ID: 6279; Accession number: BC005928; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 282; Sequence: atgttgaccgagctggagaaagccttgaactctatcatcgacgtctaccacaagtactccctgataaaggggaatttccatgccgtctacagggatgacctgaagaaattgctagagaccgagtgtcctcagtatatcaggaaaaagggtgcagacgtctggttcaaagagttggatatcaacactgatggtgcagttaacttccaggagttcctcattctggtgataaagatgggcgtggcagcccacaaaaaaagccatgaagaaagccacaaagagtag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  S100A8   cloning  
• Gene symbol
  S100A8
• Short name
  S100A8 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  S100 calcium binding protein A8 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  S100 calcium binding protein A8, 60B8AG and CAGA and CFAG and CGLA and CP-10 and L1Ag and MA387 and MIF and MRP8 and NIF and P8, S100A8 and IDBG-102654 and ENSG00000143546 and 6279, RAGE receptor binding, nuclei, S100a8 and IDBG-168077 and ENSMUSG00000056054 and 20201, S100A8 and IDBG-632868 and ENSBTAG00000012640 and 616818

Gene info

• Identity
  HGNC:10498
• Gene
  S100A8
• Long gene name
  S100 calcium binding protein A8
• Synonyms gene
  • CAGA
  • CFAG
• Synonyms gene name
  • calgranulin A
  • cystic fibrosis antigen
• Synonyms
  • P8
  • MRP8
  • MRP-8
  • 60B8AG
  • CGLA
  • S100-A8
• Synonyms name
  • Migration inhibitory factor-related protein 8
  • Calprotectin L1L subunit
  • Leukocyte L1 complex light chain
• GenBank acession
  • BC005928
• Locus
  1q21.3
• Discovery year
  1989-05-19
• Entrez gene record
  6279
• RefSeq identity
  • NM_002964
• Classification
  • S100 calcium binding proteins
  • EF-hand domain containing
• VEGA ID
  OTTHUMG00000013124

Similar products