S100A14 cloning plasmid
-
Catalog numberCSB-CL875728HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the S100A14 gene.
-
SpecificationsGene name: S100A14; Gene ID: 57402; Accession number: BC005019; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 315; Sequence: atgggacagtgtcggtcagccaacgcagaggatgctcaggaattcagtgatgtggagagggccattgagaccctcatcaagaactttcaccagtactccgtggagggtgggaaggagacgctgaccccttctgagctacgggacctggtcacccagcagctgccccatctcatgccgagcaactgtggcctggaagagaaaattgccaacctgggcagctgcaatgactctaaactggagttcaggagtttctgggagctgattggagaagcggccaagagtgtgaagctggagaggcctgtccgggggcactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolS100A11P1, S100A14
-
Short nameS100A14 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameS100 calcium binding protein A14 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetS100 calcium binding protein A14, S100A14 and IDBG-102727 and ENSG00000189334 and 57402, chemokine receptor binding, Cytoplasm, S100a14 and IDBG-167833 and ENSMUSG00000042306 and 66166, S100A14 and IDBG-632829 and ENSBTAG00000021377 and 618250
-
Gene info
-
Identity
-
Gene
-
Long gene nameS100A11 pseudogene 1
-
Synonyms gene
-
Synonyms gene name
- S100 calcium-binding protein A14 (calgizzarin)
- S100 calcium binding protein A11 pseudogene
- S100 calcium binding protein A11 pseudogene 1
-
GenBank acession
-
Locus
-
Discovery year2000-03-03
-
Entrez gene record
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameS100 calcium binding protein A14
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2002-10-30
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- S100 calcium binding proteins
-
VEGA ID