S100A14 cloning plasmid

  • Catalog number
    CSB-CL875728HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the S100A14 gene.
  • Specifications
    Gene name: S100A14; Gene ID: 57402; Accession number: BC005019; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 315; Sequence: atgggacagtgtcggtcagccaacgcagaggatgctcaggaattcagtgatgtggagagggccattgagaccctcatcaagaactttcaccagtactccgtggagggtgggaaggagacgctgaccccttctgagctacgggacctggtcacccagcagctgccccatctcatgccgagcaactgtggcctggaagagaaaattgccaacctgggcagctgcaatgactctaaactggagttcaggagtttctgggagctgattggagaagcggccaagagtgtgaagctggagaggcctgtccgggggcactga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
  • Gene symbol
    S100A11P1, S100A14
  • Short name
    S100A14 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    S100 calcium binding protein A14 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    S100 calcium binding protein A14, S100A14 and IDBG-102727 and ENSG00000189334 and 57402, chemokine receptor binding, Cytoplasm, S100a14 and IDBG-167833 and ENSMUSG00000042306 and 66166, S100A14 and IDBG-632829 and ENSBTAG00000021377 and 618250
Gene info
  • Identity
  • Gene
  • Long gene name
    S100A11 pseudogene 1
  • Synonyms gene
  • Synonyms gene name
    • S100 calcium-binding protein A14 (calgizzarin)
    • S100 calcium binding protein A11 pseudogene
    • S100 calcium binding protein A11 pseudogene 1
  • GenBank acession
  • Locus
  • Discovery year
    2000-03-03
  • Entrez gene record
  • VEGA ID
Gene info
Similar products
Filters
Contact
Chat with gentaur.com employee