S100A13 cloning plasmid

• Catalog number
  CSB-CL859514HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the S100A13 gene.
• Specifications
  Gene name: S100A13; Gene ID: 6284; Accession number: BC000632; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 297; Sequence: atggcagcagaaccactgacagagctagaggagtccattgagaccgtggtcaccaccttcttcacctttgcaaggcaggagggccggaaggatagcctcagcgtcaacgagttcaaagagctggttacccagcagttgccccatctgctcaaggatgtgggctctcttgatgagaagatgaagagcttggatgtgaatcaggactcggagctcaagttcaatgagtactggagattgattggggagctggccaaggaaatcaggaagaagaaagacctgaagatcaggaagaagtaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  S100A13   cloning  
• Gene symbol
  S100A13
• Short name
  S100A13 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  S100 calcium binding protein A13 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  S100 calcium binding protein A13, S100A13 and IDBG-102736 and ENSG00000189171 and 6284, RAGE receptor binding, nuclei, S100a13 and IDBG-167784 and ENSMUSG00000042312 and 20196, S100A13 and IDBG-632825 and ENSBTAG00000021378 and 404146

Gene info

• Identity
  HGNC:10490
• Gene
  S100A13
• Long gene name
  S100 calcium binding protein A13
• Synonyms gene name
  • S100 calcium-binding protein A13
• GenBank acession
  • AK097132
• Locus
  1q21.3
• Discovery year
  1997-10-30
• Entrez gene record
  6284
• Pubmed identfication
  • 8985590
• RefSeq identity
  • NM_005979
• Classification
  • S100 calcium binding proteins
• VEGA ID
  OTTHUMG00000036641

Similar products