RYBP cloning plasmid

• Catalog number
  CSB-CL854036HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the RYBP gene.
• Specifications
  Gene name: RYBP; Gene ID: 23429; Accession number: BC014959; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 687; Sequence: atgaccatgggcgacaagaagagcccgaccaggccaaaaagacaagcgaaacctgccgcagacgaagggttttgggattgtagcgtctgcaccttcagaaacagtgctgaagcctttaaatgcagcatctgcgatgtgaggaaaggcacctccaccagaaaacctcggatcaattctcagctggtggcgcaacaagtggcacaacagtatgccaccccaccaccccctaaaaaggagaagaaggagaaagttgaaaagcaggacaaagagaaacctgagaaagacaaggaaattagtcctagtgttaccaagaaaaataccaacaagaaaaccaaaccaaagtctgacattctgaaagatcctcctagtgaagcaaacagcatacagtctgcaaatgctacaacaaagaccagcgaaacaaatcacacctcaaggccccggctgaaaaacgtggacaggagcactgcacagcagttggcagtaactgtgggcaacgtcaccgtcattatcacagactttaaggaaaagactcgctcctcatcgacatcctcatccacagtgacctccagtgcagggtcagaacagcagaaccagagcagctcggggtcagagagcacagacaagggctcctcccgttcctccacgccaaagggcgacatgtcagcagtcaatgatgaatctttctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  RYBP   cloning  
• Gene symbol
  RYBP
• Short name
  RYBP cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  RING1 and YY1 binding protein cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  RING1 and YY1 binding protein, AAP1 and DEDAF and YEAF1, RYBP and IDBG-44775 and ENSG00000163602 and 23429, zinc ion binding, nuclei, Rybp and IDBG-172988 and ENSMUSG00000072872 and 56353,628746, RYBP and IDBG-644964 and ENSBTAG00000022689 and 616217

Gene info

• Identity
  HGNC:10480
• Gene
  RYBP
• Long gene name
  RING1 and YY1 binding protein
• Synonyms
  • YEAF1
  • AAP1
  • DEDAF
• Synonyms name
  • YY1 and E4TF1 associated factor 1
  • ring1 interactor RYBP
  • apoptin-associating protein 1
  • death effector domain-associated factor
• GenBank acession
  • AF179286
• Locus
  3p13
• Discovery year
  2000-01-28
• Entrez gene record
  23429
• Pubmed identfication
  • 10369680
• RefSeq identity
  • NM_012234
• Classification
  • Zinc fingers RANBP2-type
• VEGA ID
  OTTHUMG00000159190

Similar products