RPS3A cloning plasmid

• Catalog number
  CSB-CL020444HU2-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the RPS3A gene.
• Specifications
  Gene name: RPS3A; Gene ID: 6189; Accession number: BC066926; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 795; Sequence: atggcggttagcaagaacaagcgccttacgaaaggcggcaaaaagggagccaagaagaaagtggttgatccattttctaagaaagattggtatgatgtgaaagcacctgctatgttcaatataagaaatattggaaagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtctcaagggtcgtgtgtttgaagtgagtcttgctgatttgcagaatgatgaagttgcatttagaaaattcaagctgattactgaagatgttcagggtaaaaactgcctgactaacttccatggcatggatcttacccgtgacaaaatgtgttccatggtcaaaaaatggcagacaatgattgaagctcacgttgatgtcaagactaccgatggttacttgcttcgtctgttctgtgttggttttactaaaaaacgcaacaatcagatacggaagacctcttatgctcagcaccaacaggtccgccaaatccggaagaagatgatggaaatcatgacccgagaggtgcagacaaatgacttgaaagaagtggtcaataaattgattccagacagcattggaaaagacatagaaaaggcttgccaatctatttatcctctccatgatgtcttcgttagaaaagtaaaaatgctgaagaagcccaagtttgaattgggaaagctcatggagcttcatggtgaaggcagtagttctggaaaagccactggggacgagacaggtgctaaagttgaacgagctgatggatatgaaccaccagtccaagaatctgtttaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  RPS3A   cloning  
• Gene symbol
  RPS3A
• Short name
  RPS3A cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  ribosomal protein S3A cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  ribosomal protein S3A, FTE1 and MFTL and S3A, RPS3A and IDBG-41024 and ENSG00000145425 and 6189,8944, poly(A) RNA binding, nuclei, Rps3a and IDBG-155900 and ENSMUSG00000028081 and 20091, RPS3A and IDBG-629193 and ENSBTAG00000009908 and 282053

Gene info

• Identity
  HGNC:10421
• Gene
  RPS3A
• Long gene name
  ribosomal protein S3A
• Synonyms gene
  • MFTL
• Synonyms
  • S3A
• GenBank acession
  • X87373
• Locus
  4q31.3
• Discovery year
  1992-09-17
• Entrez gene record
  6189
• Pubmed identfication
  • 8647443
  • 1398113
• Classification
  • Small nucleolar RNA protein coding host genes
  • S ribosomal proteins
• VEGA ID
  OTTHUMG00000161445

Similar products