PSMA6 cloning plasmid
-
Catalog numberCSB-CL018871HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PSMA6 gene.
-
SpecificationsGene name: PSMA6; Gene ID: 5687; Accession number: BC023659; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 741; Sequence: atgtcccgtggttccagcgccggttttgaccgccacattaccattttttcacccgagggtcggctctaccaagtagaatatgcttttaaggctattaaccagggtggccttacatcagtagctgtcagagggaaagactgtgcagtaattgtcacacagaagaaagtacctgacaaattattggattccagcacagtgactcacttattcaagataactgaaaacattggttgtgtgatgaccggaatgacagctgacagcagatcccaggtacagagggcacgctatgaggcagctaactggaaatacaagtatggctatgagattcctgtggacatgctgtgtaaaagaattgccgatatttctcaggtctacacacagaatgctgaaatgaggcctcttggttgttgtatgattttaattggtatagatgaagagcaaggccctcaggtatataagtgtgatcctgcaggttactactgtgggtttaaagccactgcagcgggagttaaacaaactgagtcaaccagcttccttgaaaaaaaagtgaagaagaaatttgattggacatttgagcagacagtggaaactgcaattacatgcctgtctactgttctatcaattgatttcaaaccttcagaaatagaagttggagtagtgacagttgaaaatcctaaattcaggattcttacagaagcagagattgatgctcaccttgttgctctagcagagagagactaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPSMA6P1, PSMA6
-
Short namePSMA6 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameproteasome (prosome, macropain) subunit, alpha classification, 6 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetproteasome (prosome, macropain) subunit, alpha type, 6, PSMA6 and IDBG-4735 and ENSG00000100902 and 5687, NF-kappaB binding, nuclei, Psma6 and IDBG-140647 and ENSMUSG00000021024 and 26443, PSMA6 and IDBG-632540 and ENSBTAG00000009683 and 507213
-
Gene info
-
Identity
-
Gene
-
Long gene nameproteasome subunit alpha 6 pseudogene 1
-
Synonyms gene
-
Synonyms gene name
- proteasome (prosome, macropain) subunit, alpha type, 6 pseudogene
- proteasome (prosome, macropain) subunit, alpha type, 6 pseudogene 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2003-02-11
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameproteasome 20S subunit alpha 6
-
Synonyms gene name
- proteasome (prosome, macropain) subunit, alpha type, 6
- proteasome subunit alpha 6
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1995-05-03
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Proteasome
-
VEGA ID