PSMA3 cloning plasmid
-
Catalog numberCSB-CL018867HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PSMA3 gene.
-
SpecificationsGene name: PSMA3; Gene ID: 5684; Accession number: BC005265; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 747; Sequence: atgagctcaatcggcactgggtatgacctgtcagcctctacattctctcctgacggaagagtttttcaagttgaatatgctatgaaggctgtggaaaatagtagtacagctattggaatcagatgcaaagatggtgttgtctttggggtagaaaaattagtcctttctaaactttatgaagaaggttccaacaaaagactttttaatgttgatcggcatgttggaatggcagtagcaggtttgttggcagatgctcgttctttagcagacatagcaagagaagaagcttccaacttcagatctaactttggctacaacattccactaaaacatcttgcagacagagtggccatgtatgtgcatgcatatacactctacagtgctgttagaccttttggctgcagtgtgaatgacggtgcgcaactctacatgattgacccatcaggtgtttcatacggttattggggctgtgccatcggcaaagccaggcaagctgcaaagacggaaatagagaagcttcagatgaaagaaatgacctgccgtgatatcgttaaagaagttgcaaaaataatttacatagtacatgacgaagttaaggataaagcttttgaactagaactcagctgggttggtgaattaactaatggaagacatgaaattgttccaaaagatataagagaagaagcagagaaatatgctaaggaatctctgaaggaagaagatgaatcagatgatgataatatgtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPSMA3, PSMA3-AS1
-
Short namePSMA3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameproteasome (prosome, macropain) subunit, alpha classification, 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetproteasome (prosome, macropain) subunit, alpha type, 3, HC8 and PSC3, PSMA3 and IDBG-7749 and ENSG00000100567 and 5684, protein binding, nuclei, Psma3 and IDBG-146271 and ENSMUSG00000060073 and 19167, PSMA3 and IDBG-646732 and ENSBTAG00000002808 and 505176
-
Gene info
-
Identity
-
Gene
-
Long gene nameproteasome 20S subunit alpha 3
-
Synonyms gene name
- proteasome (prosome, macropain) subunit, alpha type, 3
- proteasome subunit alpha 3
-
Synonyms
-
Synonyms name
-
Locus
-
Discovery year1995-05-03
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Proteasome
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene namePSMA3 antisense RNA 1
-
Synonyms
-
Locus
-
Discovery year2014-11-20
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Antisense RNAs
-
VEGA ID