PLA2G1B cloning plasmid

• Catalog number
  CSB-CL018090HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the PLA2G1B gene.
• Specifications
  Gene name: PLA2G1B; Gene ID: 5319; Accession number: BC005386; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 213; Sequence: atgaaactccttgtgctagctgtgctgctcacagtggccgccgccgacagcggcatcagccctcgggccgtgtggcagttccgcaaaatgatcaagtgcgtgatcccggggagtgaccccttcttggaatacaacaactacggctgctactgtggcttggggggctcaggcacccccgtggatgaactggacaagcaaaaacaaagagtgtga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  PLA2G1B   cloning  
• Gene symbol
  PLA2G1B
• Short name
  PLA2G1B cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  phospholipase A2, family IB (pancreas) cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  phospholipase A2, group IB (pancreas), PLA2 and PLA2A and PPLA2, PLA2G1B and IDBG-60467 and ENSG00000170890 and 5319, calcium-dependent phospholipase A2 activity, Extracellular, Pla2g1b and IDBG-193845 and ENSMUSG00000029522 and 18778, PLA2G1B and IDBG-634759 and ENSBTAG00000026732 and 282457

Gene info

• Identity
  HGNC:9030
• Gene
  PLA2G1B
• Long gene name
  phospholipase A2 group IB
• Synonyms gene
  • PLA2
  • PPLA2
  • PLA2A
• Synonyms gene name
  • phospholipase A2, group IB (pancreas)
• Locus
  12q24.31
• Discovery year
  1986-01-01
• Entrez gene record
  5319
• Pubmed identfication
  • 8175726
• Classification
  • Phospholipases
• VEGA ID
  OTTHUMG00000169343

Similar products