PCDHGC3 cloning plasmid
-
Catalog numberCSB-CL892155HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PCDHGC3 gene.
-
SpecificationsGene name: PCDHGC3; Gene ID: 5098; Accession number: BC004321; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 183; Sequence: atgggattgagcgcccgctacggaccccagttcaccctgcagcacgtgcccgactaccgccagaatgtctacatcccaggcagcaatgccacactgaccaacgcagctggcaagcgggatggcaaggccccagcaggtggcaatggcaacaagaagaagtcgggcaagaaggagaagaagtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPCDHGC3
-
Short namePCDHGC3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameprotocadherin g subfamily C, 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetprotocadherin gamma subfamily C, 3, PC43 and PCDH-GAMMA-C3 and PCDH2, PCDHGC3 and IDBG-408922 and ENSG00000240184 and 5098, calcium ion binding, Plasma membranes, Pcdhac2 and IDBG-139382 and ENSMUSG00000007440 and 116731,12936,12942,12943,192161,192164,353234,353236,353237, PCDHGC3 and IDBG-646108 and ENSBTAG00000017349 and 100125301,521340,532241
-
Gene info
-
Identity
-
Gene
-
Long gene nameprotocadherin gamma subfamily C, 3
-
Synonyms gene
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2000-08-22
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Clustered protocadherins
-
VEGA ID