PCDHGC3 cloning plasmid

• Catalog number
  CSB-CL892155HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the PCDHGC3 gene.
• Specifications
  Gene name: PCDHGC3; Gene ID: 5098; Accession number: BC004321; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 183; Sequence: atgggattgagcgcccgctacggaccccagttcaccctgcagcacgtgcccgactaccgccagaatgtctacatcccaggcagcaatgccacactgaccaacgcagctggcaagcgggatggcaaggccccagcaggtggcaatggcaacaagaagaagtcgggcaagaaggagaagaagtaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  PCDHGC3   cloning  
• Gene symbol
  PCDHGC3
• Short name
  PCDHGC3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  protocadherin g subfamily C, 3 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  protocadherin gamma subfamily C, 3, PC43 and PCDH-GAMMA-C3 and PCDH2, PCDHGC3 and IDBG-408922 and ENSG00000240184 and 5098, calcium ion binding, Plasma membranes, Pcdhac2 and IDBG-139382 and ENSMUSG00000007440 and 116731,12936,12942,12943,192161,192164,353234,353236,353237, PCDHGC3 and IDBG-646108 and ENSBTAG00000017349 and 100125301,521340,532241

Gene info

• Identity
  HGNC:8716
• Gene
  PCDHGC3
• Long gene name
  protocadherin gamma subfamily C, 3
• Synonyms gene
  • PCDH2
• Synonyms
  • PC-43
  • PC43
  • PCDH-GAMMA-C3
• Synonyms name
  • cadherin-like 2
  • protocadherin 2
  • protocadherin 43
• GenBank acession
  • AF152337
• Locus
  5q31.3
• Discovery year
  2000-08-22
• Entrez gene record
  5098
• Pubmed identfication
  • 9360932
  • 8508762
• RefSeq identity
  • NM_002588
• Classification
  • Clustered protocadherins
• VEGA ID
  OTTHUMG00000129613

Similar products