OSMR cloning plasmid
-
Catalog numberCSB-CL857869HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the OSMR gene.
-
SpecificationsGene name: OSMR; Gene ID: 9180; Accession number: BC063468; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 648; Sequence: atggctctatttgcagtctttcagacaacattcttcttaacattgctgtccttgaggacttaccagagtgaagtcttggctgaacgtttaccattgactcctgtatcacttaaagtttccaccaattctacgcgtcagagtttgcacttacaatggactgtccacaaccttccttatcatcaggaattgaaaatggtatttcagatccagatcagtaggattgaaacatccaatgtcatctgggtggggaattacagcaccactgtgaagtggaaccaggttctgcattggagctgggaatctgagctccctttggaatgtgccacacactttgtaagaataaagagtttggtggacgatgccaagttccctgagccaaatttctggagcaactggagttcctgggaggaagtcagtgtacaagattctactggacaggatatattgttcgttttccctaaagataagctggtggaagaaggcaccaatgttaccatttgttacgtttctaggaacattcaaaataatgtatcctgttatttggaagggaaacagattcatggagaacaacttgatccacatgtaactgcattcaacttgaatagtgtgcctttcattaggaataaatggacaaatatctattgttag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolOSMR-DT, OSMR
-
Short nameOSMR cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameoncostatin M receptor cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetoncostatin M receptor, OSMRB and PLCA1, OSMR and IDBG-17615 and ENSG00000145623 and 9180, growth factor binding, multiple, Osmr and IDBG-128241 and ENSMUSG00000022146 and 18414, BT.103407 and IDBG-629972 and ENSBTAG00000033107 and 514720
-
Gene info
-
Identity
-
Gene
-
Long gene nameOSMR divergent transcript
-
Synonyms gene
-
Synonyms gene name
- OSMR antisense RNA 1 (head to head)
-
Locus
-
Discovery year2014-04-03
-
Entrez gene record
-
RefSeq identity
-
Classification
- Divergent transcripts
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameoncostatin M receptor
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1999-02-17
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Fibronectin type III domain containing
-
VEGA ID