NRP2 cloning plasmid
-
Catalog numberCSB-CL016092HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the NRP2 gene.
-
SpecificationsGene name: NRP2; Gene ID: 8828; Accession number: BC009222; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 300; Sequence: atggatatgtttcctctcacctgggttttcttagccctctacttttcaagacaccaagtgagaggccaaccagacccaccgtgcggaggtcgtttgaattccaaagatgctggctatatcacctctcccggttacccccaggactacccctcccaccagaactgcgagtggattgtttacgcccccgaacccaaccagaagattgtcctcaacttcaaccctcactttgaaatcgagaagcacgactgcaacttgctgtctgcttggaaaatttcactcacaagccgcagctttgcctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolNRP2, NELL2
-
Short nameNRP2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameneuropilin 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetneuropilin 2, NP2 and NPN2 and PRO2714 and VEGF165R2, NRP2 and IDBG-79320 and ENSG00000118257 and 8828, metal ion binding, Extracellular, Nrp2 and IDBG-160044 and ENSMUSG00000025969 and 18187, NRP2 and IDBG-643390 and ENSBTAG00000011971 and 541004
-
Gene info
-
Identity
-
Gene
-
Long gene nameneuropilin 2
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1998-12-23
-
Entrez gene record
-
Pubmed identfication
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameneural EGFL like 2
-
Synonyms gene name
- nel (chicken)-like 2
- NEL-like 2 (chicken)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1996-07-17
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID