NFKBIE cloning plasmid

• Catalog number
  CSB-CL015764HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the NFKBIE gene.
• Specifications
  Gene name: NFKBIE; Gene ID: 4794; Accession number: BC011676; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1086; Sequence: atgtcggaggcgcggaaggggccggacgaggcggaggagagccagtacgactctggcattgagtctctgcgctctctgcgctccctacccgagtccacctcggctccagcctccgggccctcggacggcagcccccagccctgcacccatcctccgggacccgtcaaggaaccacaggagaaggaagacgcggatggggagcgggctgattccacctatggctcctcctcgctcacctacaccctgtccttgctggggggccccgaggctgaggacccggccccacgcctgccactcccccacgtgggggcgctgagccctcagcagctggaagcactcacttacatctccgaggacggagacacgctggtccacctggcagtgattcatgaggccccagcggtgctgctctgttgcctggctttgctgccccaggaggtcctggacattcaaaataacctttaccagacagcactccatctggctgtacatctggaccaaccgggcgcagttcgggcactggtgctgaagggggccagccgggcactacaggaccggcatggtgacacagcccttcatgtggcctgccagcgccagcacttggcctgtgcccgctgcctgctggaagggcggccagagccaggcagaggaacatctcactctctggacctccagctgcaaaactggcaaggtctggcttgtctccacattgccacccttcagaagaaccaaccactcatggaattgctgcttcggaatggagctgacattgatgtgcaggagggcaccagtggtaagacagcgctgcacctggctgtggaaacccaagagcggggcctggtacagttcctgctccaggctggtgcccaggtagatgcccgcatgctgaacgggtgcacacccctgcacctggcagctggccggggtctcatgggcatctcatccactctgtgcaaggcgggtgctgactccctgctgcggaatgtggaggatgagacgccccaggacctgactgaggaatcccttgtccttttgccctttgatgacctgaagatctcagggaaactgctgctgtgtaccgactga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  NFKBIE   cloning  
• Gene symbol
  NFKBIE
• Short name
  NFKBIE cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  nuclear factor on kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon, IKBE, NFKBIE and IDBG-89543 and ENSG00000146232 and 4794, protein binding, Cytoplasm, Nfkbie and IDBG-185407 and ENSMUSG00000023947 and 18037, NFKBIE and IDBG-632192 and ENSBTAG00000013705 and 506727

Gene info

• Identity
  HGNC:7799
• Gene
  NFKBIE
• Long gene name
  NFKB inhibitor epsilon
• Synonyms gene name
  • nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
• Synonyms
  • IKBE
• Synonyms name
  • NF-kappa-B inhibitor epsilon
• GenBank acession
  • U91616
• Locus
  6p21.1
• Discovery year
  1997-07-01
• Entrez gene record
  4794
• Pubmed identfication
  • 9135156
• Classification
  • Ankyrin repeat domain containing
• VEGA ID
  OTTHUMG00000014762

Similar products