NDUFS3 cloning plasmid
-
Catalog numberCSB-CL015662HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the NDUFS3 gene.
-
SpecificationsGene name: NDUFS3; Gene ID: 4722; Accession number: BC000617; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 795; Sequence: atggcggcggcggcggtagccaggctgtggtggcgcgggatcttgggggcctcggcgctgaccagggggactgggcgaccctccgttctgttgctgccggtgaggcgggagagcgccggggccgacacgcgccccactgtcagaccacggaatgatgtggcccacaagcagctctcagcttttggagagtatgtggctgaaatcttgcccaagtatgtccaacaagttcaggtgtcctgcttcaatgagttagaggtctgtatccatcctgatggcgtcatcccagtgctgactttcctcagggatcacaccaatgcacagttcaaatctctggttgacttgacagcagtggacgtcccaactcggcaaaaccgttttgagattgtctacaacctgttgtctctgcgcttcaactcacggatccgtgtgaagacctacacagatgagctgacgcccattgagtctgctgtctctgtgttcaaggcagccaactggtatgaaagggagatctgggacatgtttggagtcttctttgctaaccaccctgatctaagaaggatcctgacagattatggcttcgagggacatcctttccggaaagactttcctctatctggctatgttgagttacgttatgatgatgaagtgaagcgggtggtggcagagccggtggagttggcccaagagttccgcaaatttgacctgaacagcccctgggaggctttcccagtctatcgccaacccccggagagtctcaagcttgaagccggagacaagaagcctgatgccaagtag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolNDUFS3
-
Short nameNDUFS3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameNADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetNADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase), CI-30, NDUFS3 and IDBG-239864 and ENSG00000213619 and 4722, oxidoreductase activity, nuclei, Ndufs3 and IDBG-189838 and ENSMUSG00000005510 and 68349, NDUFS3 and IDBG-637482 and ENSBTAG00000018483 and 287327
-
Gene info
-
Identity
-
Gene
-
Long gene nameNADH:ubiquinone oxidoreductase core subunit S3
-
Synonyms gene name
- NADH dehydrogenase (ubiquinone) Fe-S protein 3 (30kD) (NADH-coenzyme Q reductase)
- NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1995-11-08
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- NADH:ubiquinone oxidoreductase core subunits
-
VEGA ID