NDN cloning plasmid
-
Catalog numberCSB-CL859515HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the NDN gene.
-
SpecificationsGene name: NDN; Gene ID: 4692; Accession number: BC008750; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 966; Sequence: atgtcagaacaaagtaaggatctgagcgaccctaactttgcagccgaggcccccaactccgaggtgcacagcagccctggggtttcggagggggttcctccgtccgcgaccctggcagagccgcagagccctcctctaggcccgacggccgctccgcaggccgcgccgcctccccaggccccgaacgacgagggcgacccgaaggccctgcagcaggctgcggaggagggccgcgcccaccaggccccgagcgcggcccagccgggcccggcaccgccagccccggcgcagctggtgcagaaggcgcacgagctcatgtggtacgtgctggtcaaggaccagaagaagatgatcatctggtttccagacatggtgaaagatgtcatcggcagctacaagaagtggtgcaggagcatcctccggcgcaccagcctcatcctcgcccgggtgttcgggctgcacctgaggctaaccagcctgcacaccatggagtttgcgctggtcaaagcgctggagcccgaggagctggacagggtggcgctgagcaaccgcatgcccatgacaggcctcctgctcatgatcctgagcctcatctacgtgaagggccgcggcgccagagagagcgccgtctggaacgtgctgcgcatcctggggctgcggccctggaagaagcactccaccttcggggacgtgcggaagctcatcactgaggagttcgtccaaatgaattacctgaagtaccagcgcgtcccatacgtggagccgcccgaatacgagttcttttggggctcccgggccagccgcgaaatcaccaagatgcaaatcatggagttcctggccagggtctttaagaaagacccccaggcctggccctcccgatacagagaagctctggaggaggccagagctctgcgggaggctaatcccactgcccactaccctcgcagcagtgtctctgaggactag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolNDN
-
Short nameNDN cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namenecdin homolog (mouse) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetnecdin homolog (mouse), HsT16328 and PWCR, NDN and IDBG-4155 and ENSG00000182636 and 4692, gamma-tubulin binding, nuclei, Ndn and IDBG-190587 and ENSMUSG00000033585 and 17984, NDN and IDBG-647846 and ENSBTAG00000002186 and 386664
-
Gene info
-
Identity
-
Gene
-
Long gene namenecdin, MAGE family member
-
Synonyms gene name
- necdin homolog (mouse)
- necdin, melanoma antigen (MAGE) family member
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1997-10-13
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- MAGE family
-
VEGA ID
-
Locus Specific Databases