MKNK2 cloning plasmid
-
Catalog numberCSB-CL881017HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the MKNK2 gene.
-
SpecificationsGene name: MKNK2; Gene ID: 2872; Accession number: BC018345; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 477; Sequence: atggccccggaggtagtggaggccttcagcgaggaggctagcatctacgacaagcgctgcgacctgtggagcctgggcgtcatcttgtatatcctactcagcggctacccgcccttcgtgggccgctgtggcagcgactgcggctgggaccgcggcgaggcctgccctgcctgccagaacatgctgtttgagagcatccaggagggcaagtacgagttccccgacaaggactgggcccacatctcctgcgctgccaaagacctcatctccaagctgctggtccgtgacgccaagcagaggctgagtgccgcccaagtcctgcagcacccctgggttcaggggtgcgccccggagaacaccttgcccactcccatggtcctgcagaggtgggacagtcacttcctcctccctccccacccctgtcgcatccacgtgcgacctggaggactggtcagaaccgttactgtgaatgagtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolMKNK2
-
Short nameMKNK2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namemitogen-stimulated protein kinase kinase interacting serine/threonine kinase 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetMAP kinase interacting serine/threonine kinase 2, GPRK7 and MNK2, MKNK2 and IDBG-15316 and ENSG00000099875 and 2872, transferase activity, nuclei, Mknk2 and IDBG-175279 and ENSMUSG00000020190 and 17347, MKNK2 and IDBG-644643 and ENSBTAG00000018049 and 538519
-
Gene info
-
Identity
-
Gene
-
Long gene nameMAPK interacting serine/threonine kinase 2
-
Synonyms gene
-
Synonyms gene name
- G protein-coupled receptor kinase 7
- MAP kinase interacting serine/threonine kinase 2
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2000-02-29
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- MAPK activated protein kinases
-
VEGA ID