MKNK2 cloning plasmid

• Catalog number
  CSB-CL881017HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the MKNK2 gene.
• Specifications
  Gene name: MKNK2; Gene ID: 2872; Accession number: BC018345; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 477; Sequence: atggccccggaggtagtggaggccttcagcgaggaggctagcatctacgacaagcgctgcgacctgtggagcctgggcgtcatcttgtatatcctactcagcggctacccgcccttcgtgggccgctgtggcagcgactgcggctgggaccgcggcgaggcctgccctgcctgccagaacatgctgtttgagagcatccaggagggcaagtacgagttccccgacaaggactgggcccacatctcctgcgctgccaaagacctcatctccaagctgctggtccgtgacgccaagcagaggctgagtgccgcccaagtcctgcagcacccctgggttcaggggtgcgccccggagaacaccttgcccactcccatggtcctgcagaggtgggacagtcacttcctcctccctccccacccctgtcgcatccacgtgcgacctggaggactggtcagaaccgttactgtgaatgagtga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  MKNK2   cloning  
• Gene symbol
  MKNK2
• Short name
  MKNK2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  mitogen-stimulated protein kinase kinase interacting serine/threonine kinase 2 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  MAP kinase interacting serine/threonine kinase 2, GPRK7 and MNK2, MKNK2 and IDBG-15316 and ENSG00000099875 and 2872, transferase activity, nuclei, Mknk2 and IDBG-175279 and ENSMUSG00000020190 and 17347, MKNK2 and IDBG-644643 and ENSBTAG00000018049 and 538519

Gene info

• Identity
  HGNC:7111
• Gene
  MKNK2
• Long gene name
  MAPK interacting serine/threonine kinase 2
• Synonyms gene
  • GPRK7
• Synonyms gene name
  • G protein-coupled receptor kinase 7
  • MAP kinase interacting serine/threonine kinase 2
• Synonyms
  • MNK2
• Synonyms name
  • Putative map kinase interacting kinase
• GenBank acession
  • AF125532
• Locus
  19p13.3
• Discovery year
  2000-02-29
• Entrez gene record
  2872
• Pubmed identfication
  • 11013076
• RefSeq identity
  • NM_199054
• Classification
  • MAPK activated protein kinases
• VEGA ID
  OTTHUMG00000180020

Similar products