LY86 cloning plasmid
-
Catalog numberCSB-CL013252HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the LY86 gene.
-
SpecificationsGene name: LY86; Gene ID: 9450; Accession number: BC038846; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 489; Sequence: atgaagggtttcacagccactctcttcctctggactctgatttttcccagctgcagtggaggcggcggtgggaaagcctggcccacacacgtggtctgtagcgacagcggcttggaagtgctctaccagagttgcgatccattacaagattttggcttttctgttgaaaagtgttccaagcaattaaaatcaaatatcaacattagatttggaattattctgagagaggacatcaaagagctttttcttgacctagctctcatgtctcaaggctcatctgttttgaatttctcctatcccatctgtgaggcggctctgcccaagttttctttctgtggaagaaggaaaggagagcagatttactatgctgggcctgtcaataatcctgaatttactattcctcagggagaataccaggttttgctggaactgtacactgaaaaacggtccaccgtggcctgtgccaatgctactatcatgtgctcctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolLY86-AS1, LY86
-
Short nameLY86 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namelymphocyte antigen 86 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetlymphocyte antigen 86, dJ80N2.1 and MD-1 and MMD-1, LY86 and IDBG-59283 and ENSG00000112799 and 9450, Extracellular, Ly86 and IDBG-145270 and ENSMUSG00000021423 and 17084, LY86 and IDBG-636528 and ENSBTAG00000031444 and 100850062,613856
-
Gene info
-
Identity
-
Gene
-
Long gene nameLY86 antisense RNA 1
-
Synonyms gene
-
Synonyms gene name
- LY86 antisense RNA (non-protein coding)
- LY86 antisense RNA 1 (non-protein coding)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2010-07-08
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Antisense RNAs
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene namelymphocyte antigen 86
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2003-02-19
-
Entrez gene record
-
Pubmed identfication
-
VEGA ID