LRRC8D cloning plasmid
-
Catalog numberCSB-CL748719HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the LRRC8D gene.
-
SpecificationsGene name: LRRC8D; Gene ID: 55144; Accession number: BC009486; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 432; Sequence: atggtcagtagcaacttttggttcaaatatcccaaaacatgctcaaaagtagaacattttgtttcaatattaggaaagtgctttgaatccccttggacgacaaaagcgttgtctgagacagcatgcgaagactcagaggaaaacaagcagagaataacaggtgcccagactctaccaaagcatgtttctaccagcagtgatgaagggagccccagtgccagtacaccaatgatcaataaaactggctttaaattttcagctgagaagcctgtgattgaagttcccagcatgacaatcctggataaaaaggatggagagcaggccaaagccctgtttgagaaagtgaggaagttccgtgcccatgtggaagatagtgacttgatctataaactctatgtggtccaaacagcttctccctttcccaaccaataa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolLRRC8D-DT, LRRC8D
-
Short nameLRRC8D cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameLRRC8D cloning plasmid
-
Alternative techniqueplasmids
-
Gene info
-
Identity
-
Gene
-
Long gene nameLRRC8D divergent transcript
-
Locus
-
Discovery year2020-08-12
-
Classification
- Divergent transcripts
Gene info
-
Identity
-
Gene
-
Long gene nameleucine rich repeat containing 8 VRAC subunit D
-
Synonyms gene
-
Synonyms gene name
- leucine rich repeat containing 5
- leucine rich repeat containing 8 family member D
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2001-10-30
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Volume regulated anion channel subunits
-
VEGA ID