LIMS2 cloning plasmid
-
Catalog numberCSB-CL770349HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the LIMS2 gene.
-
SpecificationsGene name: LIMS2; Gene ID: 55679; Accession number: BC001370; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 126; Sequence: atgaagcccgtgtgtaagaggtgctacgagaagttcccgctggagctgaagaagcggctgaagaagctgtcggagctgacctcccgcaaggcccagcccaaggccacagacctcaactctgcctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolLIMS2
-
Short nameLIMS2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameLIM and senescent cellular antigen-like domains 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetLIM and senescent cell antigen-like domains 2, LIMS2 and IDBG-69173 and ENSG00000072163 and 55679, zinc ion binding, nuclei, Lims2 and IDBG-133156 and ENSMUSG00000024395 and 225341, LIMS2 and IDBG-639117 and ENSBTAG00000006262 and 515401
-
Gene info
-
Identity
-
Gene
-
Long gene nameLIM zinc finger domain containing 2
-
Synonyms gene name
- LIM and senescent cell antigen-like domains 2
- LIM-type zinc finger domains 2
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2001-07-26
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- LIM zinc finger domain containing
-
VEGA ID