KRAS cloning plasmid

  • Catalog number
    CSB-CL012493HU1-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the KRAS gene.
  • Specifications
    Gene name: KRAS; Gene ID: 3845; Accession number: BC013572; Vector: pENTR223.1
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 567; Sequence: atgactgaatataaacttgtggtagttggagctggtggcgtaggcaagagtgccttgacgatacagctaattcagaatcattttgtggacgaatatgatccaacaatagaggattcctacaggaagcaagtagtaattgatggagaaacctgtctcttggatattctcgacacagcaggtcatgaggagtacagtgcaatgagggaccagtacatgaggactggggagggctttctttgtgtatttgccataaataatactaaatcatttgaagatattcaccattatagagaacaaattaaaagagttaaggactctgaagatgtacctatggtcctagtaggaaataaatgtgatttgccttctagaacagtagacacaaaacaggctcaggacttagcaagaagttatggaattccttttattgaaacatcagcaaagacaagacagggtgttgatgatgccttctatacattagttcgagaaattcgaaaacataaagaaaagatgagcaaagatggtaaaaagaagaaaaagaagtcaaagacaaagtgtgtaattatgtaa
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    KRAS   cloning  
  • Gene symbol
    KRAS
  • Short name
    KRAS cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog, C-K-RAS and CFC2 and K-RAS2A and K-RAS2B and K-RAS4A and K-RAS4B and KI-RAS and KRAS1 and KRAS2 and NS and NS3 and RASK2, KRAS and IDBG-23889 and ENSG00000133703 and 3845, protein complex binding, Plasma membranes, Kras and IDBG-197719 and ENSMUSG00000030265 and 16653, KRAS and IDBG-638783 and ENSBTAG00000009778 and 541140
Gene info
  • Identity
  • Gene
  • Long gene name
    KRAS proto-oncogene, GTPase
  • Synonyms gene
  • Synonyms gene name
    • v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog
    • v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
    • Kirsten rat sarcoma viral oncogene homolog
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    1988-06-02
  • Entrez gene record
  • RefSeq identity
  • Classification
    • RAS type GTPase family
  • VEGA ID
  • Locus Specific Databases
Similar products
Filters
Contact
Chat with gentaur.com employee