KLRG1 cloning plasmid
-
Catalog numberCSB-CL846610HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the KLRG1 gene.
-
SpecificationsGene name: KLRG1; Gene ID: 10219; Accession number: BC012621; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 588; Sequence: atgactgacagtgttatttattccatgttagagttgcctacggcaacccaagcccagaatgactatggaccacagcaaaaatcttcctcttccaggccttcttgttcttgccttgtggcaatagctttggggcttctgactgcagttcttctgagtgtgctgctataccagtggatcctgtgccagggctccaactactccacttgtgccagctgtcctagctgcccagaccgctggatgaaatatggtaaccattgttattatttctcagtggaggaaaaggactggaattctagtctggaattctgcctagccagagactcacacctccttgtgataacggacaatcaggaaatgagcctgctccaagttttcctcagtgaggccttttgctggattggtctgaggaacaattctggctggaggtgggaagatggatcacctctaaacttctcaaggatttcttctaatagctttgtgcagacatgcggtgccatcaacaaaaatggtcttcaagcctcaagctgtgaagttcctttacactgggtgtgtaagaagtgtccctttgcagatcaagctttattctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolKLRG1
-
Short nameKLRG1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namekiller cellular lectin-like receptor subfamily G, member 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetkiller cell lectin-like receptor subfamily G, member 1, 2F1 and CLEC15A and MAFA and MAFA-2F1 and MAFA-L and MAFA-LIKE, KLRG1 and IDBG-17564 and ENSG00000139187 and 10219, carbohydrate binding, Plasma membranes, Klrg1 and IDBG-185261 and ENSMUSG00000030114 and 50928, KLRG1 and IDBG-639693 and ENSBTAG00000013640 and 100295672
-
Gene info
-
Identity
-
Gene
-
Long gene namekiller cell lectin like receptor G1
-
Synonyms gene name
- killer cell lectin-like receptor subfamily G, member 1
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1999-09-17
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- C-type lectin domain containing
- Killer cell lectin like receptors
-
VEGA ID