ITGB3BP cloning plasmid
-
Catalog numberCSB-CL622653HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ITGB3BP gene.
-
SpecificationsGene name: ITGB3BP; Gene ID: 23421; Accession number: BC009929; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 534; Sequence: atgcctgttaaaagatcactgaagttggatggtctgttagaagaaaattcatttgatccttcaaaaatcacaaggaagaaaagtgttataacttattctccaacaactggaacttgtcaaatgagtctatttgcttctcccacaagttctgaagagcaaaagcacagaaatggactatcaaatgaaaagagaaaaaaattgaatcaccccagtttaactgaaagcaaagaatctacaacaaaagacaatgatgaattcatgatgttgctatcaaaagttgagaaattgtcagaagaaatcatggagataatgcaaaatttaagtagtatacaggctttggagggcagtagagagcttgaaaatctcattggaatctcctgtgcatcacatttcttaaaaagagaaatgcagaaaaccaaagaactaatgacaaaagtgaataaacaaaaactgtttgaaaagagtacaggacttcctcacaaagcatcacgtcatcttgacagctatgaattccttaaagccattttaaactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolITGB3BP
-
Short nameITGB3BP cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameintegrin b 3 binding protein (beta3-endonexin) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetintegrin beta 3 binding protein (beta3-endonexin), CENP-R and CENPR and HSU37139 and NRIF3 and TAP20, ITGB3BP and IDBG-99389 and ENSG00000142856 and 23421, protein C-terminus binding, nuclei, Itgb3bp and IDBG-166584 and ENSMUSG00000028549 and 67733, ITGB3BP and IDBG-638555 and ENSBTAG00000030710 and 614469
-
Gene info
-
Identity
-
Gene
-
Long gene nameintegrin subunit beta 3 binding protein
-
Synonyms gene name
- integrin beta 3 binding protein (beta3-endonexin)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2000-05-08
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Constitutive centromere associated network
-
VEGA ID