IL23A cloning plasmid
-
Catalog numberCSB-CL868278HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the IL23A gene.
-
SpecificationsGene name: IL23A; Gene ID: 51561; Accession number: BC067511; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 570; Sequence: atgctggggagcagagctgtaatgctgctgttgctgctgccctggacagctcagggcagagctgtgcctgggggcagcagccctgcctggactcagtgccagcagctttcacagaagctctgcacactggcctggagtgcacatccactagtgggacacatggatctaagagaagagggagatgaagagactacaaatgatgttccccatatccagtgtggagatggctgtgacccccaaggactcagggacaacagtcagttctgcttgcaaaggatccaccagggtctgattttttatgagaagctgctaggatcggatattttcacaggggagccttctctgctccctgatagccctgtgggccagcttcatgcctccctactgggcctcagccaactcctgcagcctgagggtcaccactgggagactcagcagattccaagcctcagtcccagccagccatggcagcgtctccttctccgcttcaaaatccttcgcagcctccaggcctttgtggctgtagccgcccgggtctttgcccatggagcagcaaccctgagtccctaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolIL23A
-
Short nameIL23A cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameinterleukin 23, alpha subunit p19 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetinterleukin 23, alpha subunit p19, IL23A and IDBG-40891 and ENSG00000110944 and 51561, interleukin-23 receptor binding, Extracellular, Il23a and IDBG-197114 and ENSMUSG00000025383 and 83430, IL23A and IDBG-636072 and ENSBTAG00000004378 and 511022
-
Gene info
-
Identity
-
Gene
-
Long gene nameinterleukin 23 subunit alpha
-
Synonyms gene name
- interleukin 23, alpha subunit p19
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2001-04-10
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Interleukins
-
VEGA ID