IGSF6 cloning plasmid

• Catalog number
  CSB-CL011564HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the IGSF6 gene.
• Specifications
  Gene name: IGSF6; Gene ID: 10261; Accession number: BC017844; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 726; Sequence: atggggactgcgagcagaagcaacatcgctcgccatctgcaaaccaatctcattctattttgtgtcggtgctgtgggcgcctgtactctctctgtcacacaaccgtggtacctagaagtggactacactcatgaggccgtcaccataaagtgtaccttctccgcaaccggatgcccttctgagcaaccaacatgcctgtggtttcgctacggtgctcaccggcctgagaacctgtgcttggacgggtgcaaaagtgaggcagacaagttcacagtgagggaggccctcaaagaaaaccaagtttccctcactgtaaacagagtgacttcaaatgacagtgcaatttacatctgtggaatagcattccccagtgtgccggaagcgagagctaaacagacaggaggagggaccacactggtggtaagagaaattaagctgctcagcaaggaactgcggagcttcctgacagctcttgtatcactgctctctgtctatgtgaccggtgtgtgcgtggccttcatactcctctccaaatcaaaatccaaccctctaagaaacaaaaaaataaaagaagactcacaaaagaagaagagtgctcggcgtatttttcaggaaattgctcaagaactataccataagagacatgtggaaacaaatcagcaatctgagaaagataacaacacttatgaaaacagaagagtactttccaactatgaaaggccatag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  IGSF6   cloning  
• Gene symbol
  IGSF6
• Short name
  IGSF6 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  immunoglobulin superfamily, member 6 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  immunoglobulin superfamily, member 6, DORA, IGSF6 and IDBG-19352 and ENSG00000140749 and 10261, protein binding, Plasma membranes, Igsf6 and IDBG-208694 and ENSMUSG00000035004 and 80719, IGSF6 and IDBG-638411 and ENSBTAG00000018869 and 100140740

Gene info

• Identity
  HGNC:5953
• Gene
  IGSF6
• Long gene name
  immunoglobulin superfamily member 6
• Synonyms gene name
  • immunoglobulin superfamily, member 6
• Synonyms
  • DORA
• GenBank acession
  • AJ223183
• Locus
  16p12.2
• Discovery year
  2000-06-05
• Entrez gene record
  10261
• Pubmed identfication
  • 9809579
• Classification
  • V-set domain containing
• VEGA ID
  OTTHUMG00000090709

Similar products